Description :
From Genome Similarity Track
Location :
Scaffold_110:6585- 13259
Transcript NameFunction/comments
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_110-abinit-gene-0.53Beta-1,4-galactosyltransferase
Pytul_var.sporangiiferummaker-pug3_contig_110-snap-gene-0.24Conserved gene of unknown function

Sequence
6674 bases(100 bases per row)
TCTCCTGCTCCACCGTTTCCATTGTGCTCCTTGGTCGCTCCTTTGCTCTTGCTCTGCTTAATTCGATTCGATTTCTGCAGATCATATCCAGATACCGTGT
TGATACGATGGCGCTGAGGTGGCGCCTTCAGCAGCTCCTTGCGCTTTTTCATACTGCGAAAAACAAGACGACAGATTTTGCTAAAAATTAGATCAACAAG
CAACAATTAAATATGCACACGATCACCCAGTCGTACCTTGCTTTCTTGAGCGAGAGCATCCACTCTGGCACGTCACAGCCCGACAATTTCATCACGTTGG
CGATCGTTCGAAGGTATACCATGTCGTCTTCCGTGAAAAACGTGACCGCCAGCCCCTGTCGGCCGCCACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGGATGTAACTCACAGCACTCTGCGGGAAATCGTAGTTGATCACCATGTTTACAGCCTTGAAATCCATGCCACGACTCATTAAATCG
GTACAAATGAGCACCCACACGGCGCCGGTTCGGAATTGACGAATCACTTCGTCACGCTGCTCTTTCGTGCGATCCGCATGCACGGCGCCAACGTTGATGC
CATCATAGAGCAGCTCCTGGTACAACTCGTTCGCACGCTCCTTGTTCTGCACAAAGAGAAGCGCTGGNNNNNNNNNNNNNNNNNNNNNNNCTTCCGTGAT
GAGCTGCTTCATGGCCACGATCTTGCCTTCTTCCTTGCCAACAAACACGAGCTTTTGCTCGATCGTGGTCGCGCCAGCATTTTTCACGCCTATCGAGACC
TTGATCGGGTCGCGTAACACAGACTGCGCCATTTCTTCAACTCCCTGTAGCATCGTCGCACTGAACATCGCTCGTTGGATCTTCGGGTGCGTGCACGCCG
CAAAGATTTCATCAATTTGCTCGACAAATCCCATGTCAAACAGCCGATCAGCTTCATCCAGGCACACTATCTCCACCATCGACAAGTCGATCTTGGTCTC
CTGAATCAAATGGACGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGCGTCGCGATCAATATGTCGTGGTTCACTGTGCACTTGCTCTTGATTT
GAGCGGCAATCGTGGCAGCCGTGGCTTTCGACAACAACACAATGTGGAACTTGCGGCCCTTGCAAAGACGCGTAAACTCGGTGTGGATCTGCACCGCCAG
CTCTCTCGTTGGCGACAACACGATCGAGCGAATACCTTCCTGAGCGGGGGCTCCCAAGTTGGCAAGCATCGGGATCGCGAACGCAGCCGTTTTACCGGAA
CCCGTTGGTGNNNNNNNNNNNNNNNNNNNNNNGCATACTCGGGATCGCTTGCATCTGGATCGGTGTCGGCTCCTTGTACTCGGACGCCTCAATGTTCTTA
AGCAGCACCGCTTTCATCTTTTCCTGCTGCGCGTTCATCCGCATCTTCTCAAACTCGGCGATCGGCGCGGGTACTGCTGTTCCTTCCACGCGAATGTTCA
TCTGACGACGAAAGAGAGCAATCTCATCGCTAGCGTTTAATTGGACAAAGCATAAAAAACACGTTTGTCAAGACCGATTTACGGAAACAAGGATAATATT
CAGGAAAGTACCTGTCTTTCGATGCCTTTGGCGTGCTTTTACCCGATTTCTTCGTGCTTTCGTCGGCTTCCTGGTAGTTTTTGCCTCCTTTGAAGAGCGT
CACGTCGTTGTCTTCGTCATCATTTTCGCTGTCGTCTTCGGTATCAGCTCTCAACTCCGACACTTCGCTCCCTATTGACAGAAACATCACAGAATCTTTA
GCACACATAGCGCACTGTATTTTGCAATCATATGCAATAACAGCGACGTACCGATGGACTCCGCACGCGCCTTGCGCTGCGCCTGCTTTTTCAACTTGCG
CTTTTGCGCCTTGTCCAACTTTGGCGCCAGCAGCATCGATGCCTGCTTGCGCTCGTCGTCCTCGAGCCTCTGCTCTTCAATCGCGCCCTCGCTGAGCTTG
CGCTTGCGACTCTGCTTGCTTCCACTTTTCTTTTTCGCCGCCTTGATCTCGTTACCGGCCCAGTTAGGCACCATGTCGACGCTCAGCTTGCGGTCGCGCT
GCTTTGGCTTCTTCTCCACGGGCTTTGTCTCCTTTGCGGCATCAAAGCCGAAAAAGTCCAACGCGCTGTCATTCGCCGACTTGCTATTCGTTTTAGCCGA
GTCTACGAAAAACGGATGAAAATTTATAAATGAGGATGACTTTGCCGCGCTTTCCTGTGTGGCCCAGAGATCACAAAAGGAGCCACAGACACGCACCGTC
CTGATTTTTGAAGAGACCGATCTGCTGCTGATAGCGCTTCGTGTCAAACTTGGCGCCCTGCGTCAACGCGCCGAAGAACGAGCTCGCCATCGTGCGTGTC
TTGTCCTGGATATGTGCAGCCGAGTCGAAAGTGGTGACATGCTGTTGGCTGGCCATAAAGGAAACAACCAGAAGTACTGAATTCTATCTTAATAGAAGAC
CCTTTACATTTGCTCAAATTACAAAATCGATAAAATGTCGAAAATGTCGAAAATGAAAGATCATTTGTACTATCTTAACTAAGTAGATAAGCGTTTTGCC
GTCGATGTCTGCCCGTTTTCGCACAAAGGCGTCAGCTTTAATACAACGCACATCAAAAAAGTATCGTGACAGTTGATTCCTAATCGTGCTATTTGGTTCC
TTGATCGCTGGCGCTATTAACCTGTTTCGTGTCCTCTTCTGTCCCTGCTTCCTCAAATGGTCTCGCGTCAGCATCCAAAGAGGATCGCGCGTCGGACCAG
TGGTCGTTGCTGCCCAGGTCCACCGTAATCTTGGTGCAAAAATCGTTGAGTGCCACTGCGTCCACGTAAGTGTAGCGCAGCGACTTGATACCGTTGCGCT
TCCACGTACGAACGTGCTCTTTCAAGAGTTCGCGCTTCACCTACGCAAACGTCCACAAGGTTGCAGAACTTGGTCAGTTGTTGGAAAATAATTCAGGTGC
CTATTTAAAAACAGTATGCGCACGGTGCATTTCCACTTTGTCGCGCGCAAGACCTCGAGTTTCTCTTCAAGCTTCATCTCTTCCAAGTCGGTAATCGTAC
CGCTGTTAAAGCATGGCATCCATTCAGCACGTCCCTACGGATTGAACCCATCTATTTACAACGAGCGCTTACCTGAGAGGAGCGTGGATCGTGAGCTTTT
TCTTCACGACTCGGCAGTACAACTCGTCATCCTCGCCGCCCCACCTACGAGAAGAATCGGCAAACACAAGAGTTACTTCTCGTATAGAAATTAAAAAAGC
ACAGACGAATGTGCATGCACACTCTGTAAGCACTTACCCCCAAAAGTTGTTGGGAAACCCATTAATCTTGATGAAATCGCGTCGTGAAAAAGCCACAATA
CCACCAAAATATTTTGGATTGCTGTTGTACCTAGGTATAGTAAGTATCATGAACACGACATCTCGCTAAGAAGATCAACAAAATCCGCAGTACATACATG
GGCAGCACGCAGAGTACTGACCGATCCCAGACTCGAGCAATGTGGAACGGACCGTCCACGGGGTTGTGAGCGTAATACTGTCCAAGGTCATCCTACCATT
CACAAAAGCGCTGCCATCATTTAGCTCAAAGCAAAATAGCTCTAGTCGTTTTGCTGGTTCTTTATGCATGTACCCCAGGCAGCAGGTCGACATCGTGGAA
GATGAACACGTCGTAGTCGTTGCGCGCAATGTCAGAACCGGCGTTCAGGAGCTTGCCGCGGTTGAATTTGCGGCCATCCAGCGATTGCTCCATGATAAAA
ATGTGGAACGCACTATTCGCAGCAGCGAATATGGATGTTAGTATTAGGCAAACATGATACGAAGCAAGAGAAGATGAAAAAAAGCGCAACCACCATGGTA
CCTTAGCTTATCCTGCTTGGTCAGCAGCGCAGTCATATGCGGGACAAACTTGTCGAGATGCGCCTGGCGCTTCTGCGCGGGATGGCTATCGCGGAACGGC
ACAATGATCGCGACGCGAAGCGGTGAACGCACAGCTTCTTGCGCACTGTGGTCTGGACTCGCACTTGCCTCCAACGCTATACACCATTTGTATTTGCATG
AATATCGCCTCGATTCTCTAGCCAGAGGATATAATCCTCGTTAATGGCAACGAACCTGATAGCTTCTCACGCGCAGCGTCGCTCTCCTTCAACTCGCCGC
CTTGGCTCGGTCTTTTTGTGTTGCGCTCCCTCTCCTCCGACTGCGCAATGGCCGCCATCGCGTCGCCGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
GCGTTTGCGTTTCCTTTGCGCTGCTGTGCCTCCTCCATCCTGCAGCGCCGCACACTTGTCGGGAAGCGCATCCATCACTTATCTCTGCCTCAATTATGCG
TGAATGGTCCGCAAAAAGGCACAGCGTTCTCTTCTGAAGCTCAGTGTTACTCAGGTACTCTACCACTCTGCACACCCAGACAATGACGATGCGTCTGAAG
GCATGCTGCTACGTGACGTTGCAGAAAGAGAGAGAGGAAAAAAAGGGGTTGAGATGTCTGTTCACCTGCTTCCAGGGAGCAGACAGAGCTTAAACCACGA
GGGGTTGGATACGCACGCAGGCGCAATCCCGTCCTTGTCGAGGGAGATGCTAACCGTCTCTCGGCTCAACGAACACAAAGATAATGTCGGCGAAAATAGA
TCTATATATGTGTAACATATTGGCCAACACTTCCAAAACGAAGAAACAGAAATTCCGATACAATTGCTGTGTGAACAAAGTGGTCAAAACGAAGTACCTC
TTTTTATACATAACCTGTATATTCAAGTCCATCAAACCATCAAACATCTATTTATGGAGGGTATTTGCTTTTCAAGTAACACAACGGGTGAGAAATGACT
ACTGTTGACCCCGATGGAGCCATGTGCCGCTTGATGGTGGGTGAGTCAGTTCACTTGAGCAGCTCTTGCAGTTCGTGGCGCTTGCGGTAGTGGTACGTGT
ACGAGAACCTATTATCCACAGAGTACACAAGATACTCGTCCTCTTGCCCTTCCAGAGTATCGCTGAGCTTGGCTTTCACGTGCGTGCCGTCTCGCAGCAT
TTGTCCGATCACTGGGTCGTCGGTTGCAAATGCAATCGGGCGGCCATTCTCCAGCACGCCATGCACGTGGACGCGGCCATTTGGATCGAGAACCACTTCA
GACGCGGCACGGCCACGGCTGTCACTCGCCTGCATGTCGCTGTAGCTCGTATCACACATCACGACTTCGGCAAAGCCAGCTTCAGCAGCAGTCAGTGACT
CGTCCTCGGACGGATCTTGCTTGATCACCGTCGGACAAGTGCCATGTGGAGTGTGCCCCACAATCAACCGGTTGATGCCGCTTTCAGATAGCCTTTGGAC
GACATTGCTCGGTAATTCGGTCGGCATTCCTGATTTCTCAAGATGTCGACCCATGACGACACTCGCTGGGTAATCTGGGAGGACGTACTTTAGCAGCTCA
TTTCCTCCTCTTGTAGTGCGATCTGGGGTCCAAAGCGGCCGATCGATCCATGCGCGGACTTCACGAAGGTACCACGCGTTTAATTTGTCGACCCATTCAG
TCACAGATCGATATTCTTGGTTCGGCTCATCAGGCACACGGCCAAGCGATGAGATCCCGTTTCCAGCGCCAGAAATAAGTCCACCATGGACAAACAAGGT
ATTGTGTACAACAAACGCGAGACTTCCAAGCTCCAGGTACTCGCGGAGTACTCCTCCTTCTTGCACGCTTTCCATAAATGATTGCAGTACAGCATCGTCA
CTGATGGTAGCTGATTCTCCAAGCGAGCTGCGGTGTCTTCGGGCAAGCTCCTTGCGGCGGCGTTCAAAGTCGCCCTGTGAGCCCATCGTATGCTCCAAAA
TCCACTTTAGGCGATTCACTTTCGTGTTTGCTGGTCCAAGTAGCTCTTCATTCTGCAGCTGAACAAGTTCTTCCTCCGCTGTCTCCACGGGTTGACCCGA
TGCAGCGCATTGTGCAACAAGTTGACTCGCGAGGAATTTTTTCAGCGTAAATCTTTTCTTTTCAGGAACCCAAATGGGTCCTTCCGATGTTTCTAGTGGC
AGAAGATAGCGCAAAAAACGAAGAAGGATCTTTTAGACACCGGGGAATAGAGAAAGCAACATGGTCACAAACGGGTGGCGTACCTTTGGCCATGGTCTTG
AAGCCCATTTCACTGTCATCCAGTTCAGAAGTAAAGCGCATTTTGTTCACATCGCGATTGCCCACGAGCAACACGACCCGCTCCGGGTGTTTCTTCTTCA
ACCGCACTAACTGCTCGTAGCATCTGCAATATCGATTGTAACAAGTCATGCAAAATATCAGCTGCAACGCAAGCCTAATAATCAGCGCCAGCAATTACCG
GAAACGAGGTGACTCACTTGAGCGTCTCGCCGCCTTTGTCGCCCGCATCGCCTCCAAACACGAGGAAGCAGTTGTCGTTCAGCTCCAAATCTTCGTCATA
TCCATCGGTTTCTACTGCTTCTGGCGGTTGAGGGCGCTGCGCGTCGTGCGTGGAAGCGATCCGCAGACACGTCGACTGCCGCACAAAGTTGCGCACGTAG
TTCCAGTTCCCCTCGACGTCCGTAAGGAAGCAGATGCGTTGCGCCACCAGTGCTGCTGCTGCTGCACGCGTCAT