Description :
From Genome Similarity Track
Location :
Scaffold_211:65848- 69135
Transcript NameFunction/comments
g9407.t1hypothetical protein

Sequence
3287 bases(100 bases per row)
CGTGTTCTTCCTGAACGGGAGTGCAATTTCGTGGAAGTCGAAGCGGCAACCGACAGTGGCAACCTCGAGCACGGAGGCAGAGTACATGGCACTGTACAAC
GCCACTCAAGAGGCAGTGTGGCTGCGTCAGCTACTACTGGACGTGGGGTGTGAGTGTGTGGGTGCGACTACCATTTTTCAGGACAACCAAGGTTGCATTG
CGCTGGCCAAGAACCCAGCGTACCACTCACGCACCAAGCACATCGACTTGAAGTATCACTTCTTGCGCGAGAAGGTGGAAGACAAGGTCATCGTGCTCGA
GTACAAGCCGACAGACGAGATGATCGCAGACGGGTTTACCAAGGCACTGGCGCGACCCAAGCACCGCCAGTTTCTCGTCGGACTCGGCATGGACGCCTAA
GACGCCAAGCACAGCGCATCAAGGGAGAGTGTTAGAGGGTGCTGCGTGTGCATGTGCGTGTGTGCACCAGGTGTGGGTGCAAGGCGTGTGTGCGTGCGCG
TGCCTCTACGCGTGTGCGGGGGGATTTGTGGCGGCGTCAAGTGCTCATGATGAGACGCGCAGGTTGCGTGCGCGTGAGAACAAGCGTGTGGGAGCGTGTC
CAAGTGCTCAAGCGGCGTGGACATGCGTGTGGGTGCATAGTAGGAGTTACATATGTAGGAGTAGGGTGTGCGTGACTTTGGCCATGCAGTATGGTGTAGT
GGGTTAAGTGCCGGGTCTTTGATCCGAAGGGTGTGGGTTCGAGTCCCCACATGGACGTTTTTCTTTTTGCCGACAAGAGAGCGTAGGAGGCAGGCTAGCA
GCTAAAACTCACTCAATCAATCTCACTTTTGGTTTTGCAATCTCGGCCCGAAGCCGTCTTCTAAGCTTTCAACTCTCCGCAGCTCGTAGCCCAACTTCCT
TTTCAAATCACAAACACAGCTGCCACACCATCCATACCAGCGTACCACAACCACCGCCACGCACCGAATCCACTCGTTCCAGCGCGCAGTCACAACTCGC
CCTACAGCCGACGCTGTCGACGGCCGACTCGTATCAATTTATAGAGGTAGGACGCATCGTCAGCCAGCGAACCAACCCAGAGCATCGTTAGCCAGCAAAC
CAACCCACAGCGGCACCCAGGACACTCCCTGCCAGGCCTCGCGCACTACTCACTACTGGGGAGCCTTCTGCGCAGTGCGACGGATGGCGCAATACCCTTG
CCTATCCGTAGTCGTAGTCGTAGTCGTAGTCGTGTCAACAGTGTTCAGAGCACAAAGATACATTCACAACGAAAAGGACAGAAGCCATGAGTCCAATGCC
AAATCCTAAATCAAAGCAAGCAGAGGGCAGCAAAAGGCCCCTGCTCAAACGACCCAGTGGACGGTAGTACGCGCCCAGCAGGAAACAAGGCCGGCCGGTG
ACCGCCGCCTCGCCCACACAGTGCGGGCGCGGCTGACTCGGCGTTGGACGGAGGGGGCCGCTGCAAAACACGGGCCCAGCCGGTGATCGAAACCGGGACC
TCTCGCACCCAAAGCGAGAATCATACCACTAGACCACTAGGCCGCTAACCTAGCCTCACCACAAACACATGTCGCGCATACTGCCTTCAAATCACAAACA
CACAGCTGCCACACCATCCATACCAGCGTACCACAACCACCGCCACGCACCGACTCCACTCGTTCCAGCGCGCAGTCACAACTCGCCCTACAGCCGACGC
TGTCGACGGCCGACTCGTATCAATTTATAGAGGTAGGACGCATCGTCAGCCAGCGAACCAACCCAGAGCATCGTTAGCCAGCAAACCAACCCACAGCGGC
ACCCAGGACACTCCCTGCCAGGCCTCGCGCACTACTCACTACTGGGGAGCCTTCTGCGCAGTGCGACGGATGGCGCAATACCCTTGCCTATCCGTAGTCG
TAGTCGTAGTCGTAGTCGTAGTCGTGTCAACAGTGTTCAGAGCACAAAGATACATTCACAACGAAAAGGACAGAAGCCATGAGTCCAATGCCAAATCCTA
AAATGAAAGCAAGCAGAGGGCGCCAAAAGGCCCTGCATAAACGATAGCCAGTGGACGGTAGTACGCGCAGCAGGAACAAGGCCGGCCGGTGCCCGCCGCC
TCGCCCACACAGTGCGGGCGCGGCTGACTCGGCGTTGGACGGAGGGGGCCGCTGCAAAACACGGGCCCAGCCGGTGATCGAAACCGGGACCTCTCGCACC
CGAAGCGAGAATCATACCACTAGACCACTAGGCCGCTAACCTAGCCTCACCACAAACACATGTCGCGCATACTGCCTTCAAATCACAAACACACAGCTGC
CACACCATCCATACCAGCGTACCACAACCACCGCCACGCACCGACTCCACTCGTTCCAGCGCGCAGTCACAACTCGCCCTACAGCCGACGCTGTCGACGG
CCGACTCGTATCAATTTATAGAGGTAGGACGCATCGTCAGCCAGCGAACCAACCCAGAGCATCGTTAGCCAGCAAACCAACCCACAGCGGCACCCAGGAC
ACTCCCTGCCAGGCCTCGCGCACTACTCACTACTGGGGAGCCTTCTGCGCAGTGCGACGGATGGCGCAATACCCTTGCCTATCCGTAGTCGTAGTCGTAG
TCGTAGTCGTAGTCGTGTCAACAGTGTTCAGAGCACAAAGATACATTCACAACGAAAAGGACAGAAGCCATGAGTCCAATGCCAAATCCTAAATCAAAGC
AAGCAGAGGGCAGCAAAAGGCCCCTGCTCAAACGACCCAGTGGACGGTAGTACGCGCCCAGCAGGAAACAAGGCCGGCCGGTGACCGCCGCCTCGCCCAC
ACAGTGCGGGCGCGGCTGACTCGGCGTTGGACGGAGGGGGCCGCTGCAAAACACGGGCCCAGCCGGTGATCGAAACCGGGACCTCTCGCACCCAAAGCGA
GAATCATACCACTAGACCACTAGGCCGCTAACCTAGCCTCACCACAAACACATGTCGCGCATACTGCCTTCAAATCACAAACACACAGCTGCCACACCAT
CCATACCAGCGTACCACAACCACCGCCACGCACCGACTCCACTCGTTCCAGCGCGCAGTCACAACTCGCCCTACAGCCGACGCTGTCGACGGCCGACTCG
TATCAATTTATAGAGGTAGGACGCATCGTCAGCCAGCGAACCAACCCAGAGCATCGTTAGCCAGCAAACCAACCCACAGCGGCCCCCAGGACACTCCCTG
CCAGGCCTCGCGCACTACTCACTACTGGGGAGCCTTCTGCGCAGTGCGACGGATGGCGCAATACCCTTGCCTATCCGTAGTCGTAGT