Description :
From Genome Similarity Track
Location :
Scaffold_29:65844- 69939
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_29-fgenesh-gene-0.6Extracellular nuclease (ISS)
Pytir_DAOMBR486maker-pir_contig_29-fgenesh-gene-0.7Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_29-fgenesh-gene-0.8Cysteine protease family C54

Sequence
4095 bases(100 bases per row)
CTTTGTGGCTGTTGTAGCGAGCTCGCTATGAAGTGAAGTTGACCATGTTGCTGCTTATATTTCGAAATGGGTTTCATGGACAGGATTCGACGGTGGAAGC
GCGCTTGGGGTTCATTTATGCAGACTGTACGTGCTCCAGCCTGCTATCTACCGCTGAGGTTTGGTGGCGAACGTGGCTGAGCTGACTCTGTTTCCTATTG
TTGTCGTATGAGCAGACTCGCAGGCGTACTGGTGGTTTGAAGTCGTCGATCTCTCTCGAAAGCTCTTTCTAAGCGGCGTGATCGTATTTGTGCAGAACGG
GAGCGTCGACCAAGTGCTCCTGGCGATCACCGTCTGGTATGTTCAACTGAGAACCTGGCGATTGTGTTTGGTTGCCGAAGTCCTCGCCTCAGTCATCTCT
ACCACTTATGTTAACTTGTTTGTCGTATGCACGTCCCCTGTAGTTTGGTCACGATGTGGTTCCTCCTGTACTTCCAGCCGTACGGCGATTACTCGGATAA
CCTGATCGCGAGCGTGACGCAGCTGCAGCTTTTCCTGACGCTCTGGCTTGGCGTGATGATCCGCCTGAACGACCTGAACGAGGAGTCGCTCATCAACAAG
AGCCTGCTCAGTCTGCTGCTCGTTGGCACGTGCATCGCAGTGACGACCTTCGGCATCGGCATGATCCTTCGCGATGGCATCTTGGAGTCGCGGCGACTGT
TCTTGGAAGACAAGGCGGACCGCAAGGCGCGCATCAAGCTCGAGGTGCAGAAGCGCTGGCGCAAGGCGTTCAACTACACGTGCTATGAGTCACAGAAACA
GATGTACGGCCAGCTGAGCTTCTCATACTTCAGCGTGCCGTCGATGCTCGAAGCCTTCCGGCGCATCAAGCTCGAGTGCAAAGAGCAGAACCTGCAGGAC
ATTTGCGAATTTCTTCGCCAGCAAGAAGAGCAAGGCATTGGGCTAGCGGCCATTGGCGCGCGCCTCCCGGAGCTTGTGGAAGAGGTGGAAGAAGGGAGCG
AGGAGATCGAGAAGAGCGAGCAGGAAGAACAGGACGAGAATGTTGAAAGTGACGCTGGTGGTGCTGGCAGCGAAGATGAAGGAACCGCGCGGCGTTTTGA
ATCAGAAGGTGATGGTGCAGCCGACGATGACCTGGTCGCCGACAACCCACAGACAGAGGCTGAATGAAATGAAGTACAGTGAGAAGTTTCCCACTGCATG
TACGTTGCTTAATTCAGAGGAATGAGTCTGATGAGTGTAAAACGTGGGATATCAAGGACAGGAAGACATTCTTTTCATAAGTATCCAACGTTCCATTGCG
CCATCCATCAGCTGCATGTTTTCAGTAAATTTGCTCACAAAGAGAATGAGAAAAGGCGGCTTTAGTGCCGTACAATTGCTCGCAGTGTCCTGCTTGTGGT
CAAGCGCACGTGCAAAGAGCTCTTTTGTTCCCACTCGAGAAAGTACACCTCAATTGGTGGCTGTGAACTTTTCGCACGTGGATGGACGTTCATGCAGTCC
GTCTACCTTGTGAGGGTTAAGCTGCATACTTTCAAAGAAGCTCTCCCCTTACGCCAAGAGCTACGAACCAAGGAAGCTCCGCTAACCATGGACTCTCTCC
ACGCGGTGACGAAGGCTGCGCGCTCGCTCGCCAGCGACTGCATGGAGGACCTTCACGAAATGATCAACGCGCTTTCGTTCGTCGCGGACCTGGCCAAGAT
TCTGCTCATCAGTGCGTTCGAGGCGGCAGTGATTGTGGTCAAGAGCCTCGAGCATGGAGACGTTCCGCTTGCAGCTGCAACTTCCACGGGCAAAAGCAGC
GCTACCGACCACCAAGCACCTCAGCAAGACCACCACAACGAAGAACTCCAGTGTAAACTGCAAGAGCAGCAGCAAAAGCAGCAACACGAGCCACAATGCA
GTCAGCATAACGAGCACGACGCACCGGAAGACCACCAGCGGCTCCCAAGCATCGACGATCTCGCGTACAAGACTGTCAACGGCGCATTCAAGCTCAAGAT
CTGGATGGCGGCCGACAAGATGGCTGCCATCTTCGCCAGCCCTGAGGAGCGCCGATCCGTCTGCAAGCTGCTGAGCGCTCTCCACGCGCTTGAGAGCCGC
TTGCGCTTCCGAAAGTGGCTTCTGCCGTATTTCCGAATGCTCTTCGTGCGCTTTGACGCCGACGAGACGCGCGTCTTCGCTTATTTGGTCGCGCACCCAC
ATCTGTACGCCGGCGTCCTCGCGCGCAATGACAAAGAACTCTGGTGCTGGACGCCAGGCTGCGTCGGCTGCAACAGGCCACGCCACAAGCTCGACGAGCA
CGCCAAGGAAGTCTGACGCAGGAGAGCAACGCTAAATATCGCAATGTGCTAGTAGTAGCGCAGTAACTACGAAAACCATAGGCACACACACACACAGGAC
CAAATCAGATGTCGCGATCTTGAGCAACAAGAAGCCTCACGTACGATCGCACCTGCAGCGCGTCTTGAAGCCAAGTGTAATTGTAAGTTTTCATGGATCT
CCGTCCTGAGCACAGGGCGTCGCTTGATGAGGTAGACGACAAGCTTGCCTGCCCTCTGAGTTAGTGAGAATCTCCCGCACGCTCCTTCCACTCCCACGCA
CATTTGGCGACGCAAACGAGATCGACAGCGAGCTATGCGGCGGCATCCAGACGCTGTGCTCGCTGGCAAACCGCCACGCAAGAGCGATCGCGTTTCGCCA
CCAGCTCATGTTTTCTACTTGCTGGTGGTCCCGGAGGTCTTGTGAGCCAACTCCCGAAACAGGCAGCTTCCTTTGACCAATTTCCACATAGACTGTATAC
AACCCGTTAAAATCAGTTTTGAAGTAGACTAAATCGTCAATTTAAAAAATTCCAGGTACAAAATTACAAATTTAAAGCAAGTTGCTTTGTTGATTCATAA
TTATTGTATTATTGTGCGTACAATCCATCATATACTACCATTGTTGAGCAATTGTGCACATTGATCAAACAATTAAATGTAGTTTTGTAAATTCGGATAC
GGGTCTCAACCCAGGTCGTGTATCTGAGAAAACCCGCAAACGCGAAACCCGCGCGGAGCTCGTCGTATTTACCTTGTGTAGCTCTGTCTGATCTGAAAAG
ACATATCAAACAAGCGCAAGAAGCAGTCGGAAGAAGAAGAAGAAACGGAGAAAGAACGAACGCGCCGCCATTCGCCACCTCGCTATCTCTCTCTGTACGT
AGCTACACTTCTGTATGCGTGTCTCTCTGCCTATATGACACTCATGCACTTACCCATGCACGCACAATCCCCTTCTGGCTGTGTAGCTTCTCGCTCGTCG
GTCTTCCTCCTTTTTGTACACCTTTGCAGCCAGCAAGCACCACGGCGACGTATCTGCTTGAACGCGGCGCGGTCTGGACCTGGCTCGGAGGCGAGATCGT
GGGCAAGATGAGCCAGTTCGCGCACGGCATCTCGTCGCTCGACACGTCCAGCGCCGCCACGCTGGACACGCCCATCTGGATGCTCGGCAGACAGTTTGTG
AACGCGCAGGTAGATCTCGACGAGTACAAACAGGCATTCGAGTCCATCTTGTGGTTCACGTACCGCCGCGACTACGCCAAGATGGAGCCGTACGAGTACA
CGAGTGACGCTGGGTGGGGATGCATGCTGCGCTCGGCGCAGATGATGCTCGGTCAGGCGCTCAAGCGGAGGCTGCTGGGTCGCGACTGGCGCGTGCCGCT
GTTTAGCACCGACAAGTTGCCGACGCAGTACGTGACGCTGCTCAAATGGTTTGTAGATTCACCTGACCCTGAGTGCATCTACTCGATTCACAATATGGTG
AAGCTCGGCATGCAATACGACAAGCTGCCCGGTGAGTGGTACGGCCCCACGACTGCGGCGCAGGTGCTGCGCGATCTCGTGAACTTGCACAGTCGCGAGC
TCGGTGGAGTACTGTCGATGTATGTGCCGCAAGAAGGTGTCGTGTACACGGACGACGTGATGCGACTCTGCGTCTCGCATCTGGATGACAACGATGACAC
TTTCACCACAGGTGAGCGCAGCGCGACGGGTGCCGCCAGCCAGAAAGCCGAAGAAAGTGAGCAGGTCGCGTTCTTCGATCCGCTGCTGAATCCGC