Description :
From Genome Similarity Track
Location :
scaffold_351:6583- 7670
Transcript NameFunction/comments
g7545.t1hypothetical protein

Sequence
1087 bases(100 bases per row)
CAACGGAAGGGCAGCACCACCTCGTGCTGTAGGATATCTTCGGCTAGAGGCCGCTGCAGCGCGTCCGGATGCATCATGCTGGAGATTAAGTGCTGCAACG
AGTTGGAGTATTGTCTGTAGGTGAGCAAGCACGTTAGCACCACGCACGTGCGGTTTAAGAGAGTTTCACAGGACGTACCGGAACATGACGAGGTCACCGT
CGCGGATCTTCTGCCATTCTTCGCCGCCACTTGCCAGCGTCGTTCCTAGCGCGAGCTCGTAAATTGTGGCTCCCAGAGCGAAGACGTCGCCGGCGCGCAA
ATTATTCCGATTGCCTTCGAGCAGTTCCCTGCATTTAGACAGAAGTTAGCTTACGGGTCCTACCGCTCGTGCCTGCACAGAGCACTTACCGACTGAGATA
CCGATTGTCGCCCTCTGTGATCTCCATACTGCCGTCAAGGTGAGCAACAGTTCCCAAGTCGCCTAGCTGCAAGCGCAAATTTGCACATTTTTAGCACCAG
TGACTACGAGAGACGCAAGCGAAACACGTGAAACAAACCTTGTAGACCTCTCCAGGGCCAACCAGGACATTCTGCAGCTTCACGTCCATGTGAACCATCT
TCTTGCTGTGCATATCGAAAAGAGCCTAAGAGAAATGACGTCTAGTTAGTTTGTTGACCAATATCCGCAAAATGCGAGCACAACCACCTTACCTGGGCAA
GATGGCACAAGATCCTGCACAGCGTTTCTTCCGGAACCTTGTGTGGCGCATACTTGTTGACAAAGCCAGTCAACGAACAGCCCTCGAGGTTTTCAAGCTG
AATGTAAAGCAAGTCGTCTTCTATCCAGGCGTCGAAGTATCGAACGATGTGGTTGCTACTGCTCAACGCCGCTAGTGCCTGCACTTCCCGCAGAGCTCGT
TCCCTGTAAAGATCAATGATTAAAATCAACTCACGCTCAAACACAGAAATTGTGGATCTACGGCGAGACGTACGTGTCTGCTTTGCCTCGAAAGTGGCGC
TTGCTCTTCTTCACAGCGTATGCCCAGCCATCGATCTTCTTGATGCACTTGTACACTTTAGAAAACGACCCCGAGCCAATGAGCTAT