Description :
From Genome Similarity Track
Location :
contig_27:658260- 662829
Transcript NameFunction/comments
g7068.t1hypothetical protein

Sequence
4569 bases(100 bases per row)
GCGGCGACTGCCTGCGCGTGCTGCGCTGAGTCTCGCGCTTCTGCTGCTGCTTTCCGGCGACTGCAGGGCCGCGGGGGACCTCGTGGCGCGTCTTTACGCG
CTGGAGACGTCTGGCAGCTCCGCGAACAGGCTCTCGCTCAGCTCCAGCGCGCTGCCGAGCGCTGTAAGTAGCAGACTATCCAGCTTTTCGCTGTCCTGGA
GCGACCTGCCGGGGCTCATGCAGCGCGCGCTGCTGTGGGACTCAGGATTCGTGTTTGCGTCGGCCGTCGACGCCTCGTCATCAAGCACAGGGGACACGAA
ACTCGTGCAAATTTACACTTCGTGCGGCCAGGGGATGGGCGATTTGCTGCCGGACGTGGAGGAGTTGCAGACGCTGACGAACAGCAGCTGCAAGTTGCAA
AACTGCGGGATTATCGGCCATTTCCTGCCGGAAAACTGTCCGGTTAAGCAGGTTTTGCCCCTTACCAGGTGCGCAGTGTACGCGTCCGCTATGGACACAC
AGACGCAGTTTGCAGGCGTGTTTTGGGCCCAGGACGGACGCAGCACAGTGTCCCTGAACCCGTGCTGAGACGGCATTCCCCTCCGGCGACGCAGCCGACG
GACTCGCTCTTTGCAGTGCATTTGACAGACGCGAGCTTTACAGGGACAGACTCATGCCAGCCGCTCACGAACTTCATTCTGCCGTGTCGAGGTGTGGCAG
ATGACGTGGATATCTCCAGTCGTAGTGGGAGTGCGAGCTTTACAGCCAATAGCAGCAGTTTTACGGAGATGGACCTGTGTCCGGCCACGGAAGGAGCAGC
TATGAACGCGTGGCTTGAGCTGCAGTCGGTTCCGTCCCCGGGGACGCTCTCCACGACGGCCATTGTGCTGCTGGCAGTGTCTATGTTGATTTGTGTGGTG
TTGGCCATCTCGGTGTGGTGGCTGAGCCGATCGCGGGCGTGGCTGCAGGACGCGTACGACCGCGTCATCTTGGAGGGATCGTGGGACGACGGTAGCTGGT
CGCCGACGTCACATTTACTAGGGGGCCCACTCGCTCCGTCTCTAGCGGTCGCAGGAGCTACAGATGAGGAACGACTCACGCCCATGGAGGTTTTCTTCGG
AGCACGACCGAGAAGTCGACGGTCACCAGGGATTCACGGCACTTCAGCACTCGTAGCCACGACACGGGCCGAGATCACGCTGTCCAACGACCAGCTGTGC
CGCAAGAGCGCTATCTTGCGCGCCTTCGTGTCGGATCCGGCCATCGTGACTAAACGCATTTCGTTTGCGCAGCTCCACTTTTTGAGGCTGCTCGCCAAAG
GAGGCAGCGGGGAGGTGTGGCTGGGCCAATATGAGACTCGCTACGTGGCTATGAAGTGTTTATTGCCAACGAAACGAGAGGACCCAGAGGCCTTGGAGCA
GTTCGCAGAGGAGATCAGGATGGCGTCGTTTTTAGCGCACCCGCGGATCGTGGCCTTCTGCGGCGTAGCCTGGCAGTCGCTCTTGCACCTTTGTGCAGTG
ACGGAGTACATGCCACGCGGTGACCTAGAAAACCTGCTGGCAAATCCAATTGCTCAGAAGGAGCTGAGCTGGAACAGAGAGAAGCTCACGCTGAGCAGTG
ATATCGTCGAGGCGTTGGTGTACTTACACTCGCTGGTGCCCATCGTGATTCATCGCGATCTCAAGTCCAAGAACGTGCTGCTGGATCGGCGATTACGTGC
AAAGCTGAGCGACTTCGGACTGAGCCGCGAACGATCCGTGGAGGACACCATGACCAACGGCATTGGCACGATCTTGTGGAGTGCGCCAGAGGTATTAGAG
GGCAAACGCTACGACGAGAAGAGTGATCTGTTTTCGTTTGGTGTAGTGCTGTCTGAGATCGACACGTGCGCGCTCCCGTACGGCTTCAGCCGCCACGCCA
AGATGCGCAGTATGCAGGTCGTCCACCTCGTATCCGAAGGCAAACTGCTTCCCAACTTCCGGGACGACTGCCCGCCAGCAATACGAGCGCTCGCACAGCG
ATGCCTAAGCTTGGACCCTGCAGCGCGTCCGACAGCAATGGAAGTCGCCTTCGAACTGCGCTCTTCCATTGCTCCCCAGCTACTGCAGCAGCCGATGACG
GCACTGTTAGTAGCGGACGATGACGGCGCTGTTAACGTTAGTAGCGCGTCAACTCCCCTCACCCAGACGTCTCCAGCCTTCACAGCAGTCGAGAACAGCT
CGACGCCACCTGTATCATCATCAACCGAGACCGCAAACACGAAGGAGACCCAAACGGATCCGTGATCTTCAAGACGAAAGTAGTCGCCAACGGTTAGGAA
CGCGAGCCTTGGCAAGTCGCGTACAGACCAACGGAAGCCCATTAATTTATGAGAACAAAGCTTGTAAAAACCTGAGACCGTCGCCACCCAGCAATAGCCG
ACTGAACATGCTGACACTAGCGAAACGGACGTGATCACTGTCTCGGTGAGCCTCTGGATGTGGAGGTGGGAGACGTGGGTTTCCACACATCGATAGCGCC
ATGGACAATGACCATGAGCCATCGACCTCTAGGGCGCGCAAAGCCCTACTACTCCGTCGAGTACCGATCCTGGCACATGTCGTGAAGCAGGGACTGTGCT
CGGAAGGCGAGTTGCTGCGTGCATTGGAGTACGTGACGTACAGTGACGGAGAGTACATTTATTGCCAAGGCCAGCCGGAACGAGACTTACTATTCATCGA
GGAAGGCAAAGTTTTGATCACTCAGCGTCGGCGATCTCGTGCTATGAGCACTACAGGTAGTCGCCCGGTGGGGTTTATTCCGATGGACAGCTCGGGCGGT
GTTGTATCCTCTCGGCGGCCCTCACGACGGCGCTCGCAGATTGAAACTGAGATGGAGATCCAGCTACACAAGCACGAGGAGCTCGAATACTTTGGCGAGG
AGTCTTTGCTGCAAGGATTGGTTTCTAGAATACTCAATGCGGTGGCTAGTGGAGCGGTGACGTGTGCCGTACTCCCAGAGGCTTCATTTGCCAGGTTGCT
GGCACCGGTACACGAGTTAATGCTGCATCGGCATTTGTTGCGAATGCACGGCGTGCTGGCAAAACAGCGAGTATTCCAGCACTTCTCCGCTCGTCAACGA
CAGCACATTTTGGATCGTTGTACTCTAGAACACTACGAGGAAGGAGCTCGAATCATTCAGCAAGGTGATAAGATGACGACCGATATTTTATCTTGGCCGA
AGGGGAAGCTGATGTTGTGCTAGATGAGCCCTTGCGAGATCTTCGGCCAAATAATTATGCAGAGGGGATTGAAGGGTTTGAATATGGCGGAGAAGAAGAG
GACGGTGGGGGCAGTAGAACATCGATTGTGTGTCGAAAGGCGCTTTATCAAGGATTTGGCGAGATGGGGATCTTAGGCCGGCCTCGAACAGCGCATGTGG
TTGCTGCTGGGAGCGTGGTTTGTGCAGCGATTTCGCGAAAGACGTACGTTGGCGCTTCGCAGTTGATAGGCGTTAGTGGCGTTGATACGGACGCGGAGGC
ACTGCTTGCTATGTCTCTGATGGAGGAGTGGGCCCTTGTGGTGAAAACTCGGAGCCTCCATTTGGCGAACCCGTTGGTGTCTCGACATCTTGAAACCTTT
GTGAAAAAGTTTAAGGCCGCCTACATGCAGAAGTTTGAAGGCAAAACGCTGTATCTAGACCTGCTCCGACGAATGCACGCAGAGCCTTCACTTGCCGATG
AATTCCCGTTCGTGTCGGACCGAGTGGCTTGGGATGCACCAACATCATCGCTCAGTATCACGCGTGCTGAGACTCGACGCGTGCTACTGCTGCCTCCGGC
TGACCGCTCCCCGTTCGAGATCAGCTTCATGGCGCGCTTGCTCGAGCCTACAGCGTTCATTGGGAAGTTTGACCGGCCAGCTCATGTCGATCAGCTCACG
CTCGCTCGCGGGATCGCTCGATTTGCCTCGTTTGCCACCATCCAAAAGGACAAACACCTCTTTCGTCAAGGCAAGATCGAAAGCCGCGCCTTCCTCATCT
TGCGAGGCAACATCAGCATCGTGAACGAGGACGTCAGCACCATTCAGACCGGTCTCGCCGTCAAACACTACGACGTACTCGCCACACTCTCCGCCGGAGA
CTCATTCGGCGAGCTCTCACTTGTAACGCGACTCCAGCGTTCAGCCACAGCTCTGGCTGCCTGTGAGGCAGATTTGCTGGTACTAGAGCGTCCGCATTTG
CAGGCCTTGATGGCTCTGCTACCAGGCGTATCGGTGCAGCACGCCATGGTGGAGCGCGCCGAATTCCTTGCAACGCTCAACTTTCTCCGGGACAATGACT
TCGCGCAGTGCATTCGCGTGGCGCATGACCTCCAAGAGCAGTTCTACGAGCCACGCCACCTTTTCCTCCAAGAACCCGTGCACTTGCGTACGCTTTACAT
CGTCAAGAGCGGCGAAGTAGTTGTGTTTCTGCGTCGGCACGTGCCAGTTGCTGAGACTACAGGGACCTCAGGAGCGAATGACGTCGCACCGACCAAAGAA
GTGCTTGTCCGAGTGGCAACGATTGGACCGCAGGAGTTTTTCGGTGTCGCCATTGCCAGCGCCAACATG