Description :
From Genome Similarity Track
Location :
Scaffold_134:65826- 69089
Transcript NameFunction/comments
Phyke_g4791hypothetical protein PHYSODRAFT_534432
Phyke_g4792hypothetical protein

Sequence
3263 bases(100 bases per row)
AACTGCTAGGAGCCCTTGAATATAGCTGAAAAACTGCTCTGCGCGTTCCTGGATGACTTTGGGACTTTTCGACCCCCAGATCCTCCGCTTGGGAAAATGC
TTGGCATTCAGTTTCTCCAATTCGTCAAGAATCGGTGCACAATGTGCACAATGAGCATTCCGACCGCCATTCACTGCTGCCCCGGGGTGCTTTCGGCGGT
CGAAGACCCGCACAAACTCATCTCGTAGTGACCGAAAACCTGAATACCGTCTCGAGACGACCCACCTctctccagcaccagtgaCTGGAGCATCTTCCAG
AACCAAATCGTACTCTGTGTGCGTCCCGGGCGACACCAACGACGTGTACTGCAGAATTGATGACTCTCGTGGCGTGACCGAATGCAGCACGAAGCCGCCA
AGATGGTTGGCCAAGTTCCTCGCCCTCTTCTTAGACTTACTGACcgacgacatcgtcgacGTGGACCTGGAGGACGAGCTAGACGTCGAGCGATGCGCCA
TATACGAGCGATTGCTGGACTTGGTACTATTGAGATCGTCTCCGTCGCTTCGGCTTCGAGTGAACGAGATACTGGATGGATATCGCAGCGAGTCCAGTGT
GACGCCCGACCGGACGCTGTAGCGTTGGAGGTCGTCGATAATCGCCTCGTCCCCCGTGACGATTTTGGGTCGTGCGTTTTcgctggacgacgtcgagGAG
GGGGAGTCTAGGAAGAATGACATGACAGATTCTGATAGCGGTGGCTGGGGACGCGGTCGACGGCGCGGCTTGGCaggctgcttcagcacggGGTTTTCCT
CCATGTCCAGCGGATTCCCGTATGACATGAAGGGGGGAAGACAGCGACCGCGTGACCAATAGAGCGATGCCCAATGTCAGCTGGGGGATCCACATCAATT
GAATGTCTTGTCTATGTCTTTTATATGTATTCTATGTGTATATAGCACATCCCCCTAGGTCACGACAGTTGTATTCATGTTGTCACAAGCGACAGACATC
CGATCCAATCGACTGCTACCATGAAAAACATTATGAAAACATCATCAATGGCGTCATGGATGCTGAGAGCCGATGATGAGAACGTCGCTCATCTGGGCGC
GGTGCCCTCTGTAGCCGGCCTATCGCTGTCAAAAAATTTGCTGCCAAACAAGCGCTCCTGTACTACACTCACTCGTGCAACCATTCTCTCAGGCAAGCCT
ATGTGGACCATGCTTTTTTGCAATTGAAGGGATGGCTGGACTCGCTCCAAAGAGCCTCTTGCCTCCGAGCTCACGCGATGAGATCAACTGATTCAGCATC
GATGCCATCAAGTCAATTCGTGCTACCGACTTGCACGTGCAAAGACCAAGCATGCTTCCTGCGGGAAGGCTCACCGCTCACCGAACGCTGGCcttggcgc
tgctgtcaacAGTGTAATGGCCAAGTCTCTGTCGCTTGGGTACACAGCGGGAAATTCTTGCACGAGAGACTCCACGCCGTAGAGGAGAAGATTTGACGCG
GCCCCACCGAGATGGTCACAGTGCCGCTGTGGCCAAATGCGCCAGCCAAAGCCATGACATGGCCTAGATAGAGCGGTCAACGGCGCCGCTTGCAAGCAAA
CTGCTCGGGTAGACGTTGGCATGCTAGTCTTGTCACTTCATGTGGACGAGGTACATGTACTGGAAAGCTTGCAGTTTCAATGCGCGTCTATCCCAAGAGC
AGCGTCGAACACTGTGCCAGCAGCGTATCAGGCTCCGAGCCACATGCGCTACCGTACCTTTTTCTTGGTTATCGCTCGACCTTTATTGGTTCAACCATTA
AATTGTAGACTGAAAGGAGCTCTGGTCGTGTGGCTTTGACAACTGGAACAGACTTGAGCCACGAATGCTTATGAGATGGCAAATACACACACTTCGCGTC
GAAGCAACACGTTTGTGGCCTGTCCCGCTGTGAATGCCACTATATTTGACGGCAACAATGCCAGGGACAAAATGTGTCAAACCAAGGGCGACGAACAGAA
TGACAATAATGTGAAGAACATCTGAGGACGCACTGCGCTAGGACACACTGCGCGTTGTACAACTGCAAGAATGCTCTCCTTCGAGCGGTGCTTGGTGACC
AAGTGACATTCAAACGACTTCGTTGACTGAACCTAAACTACAGTGGGTGCTAGCCACACACTGTCGAAGTCCATGGCAAACAGCTCGATTCAACCGCCCC
CTCGTTCATTTTGCGCATTCTAGCAGCTGATCTACTCGAATTCACTTCGCCAAGCGCGTTGCTGCCAGAGCGATAATTcccatcttcttcaccgccaATT
GCCACTCACTCAATTGCCATGCCGCAGTACATGAGTTTGGCTTTACTACTGACGGCAATGGTTGTCGCCGTGAACGCCGACTCCATCCTGGAAGCGATTG
AAGTGTTCGCAGGCAGCAATTGTGCAGGAACCCCAGGCGTATTGGCCATGTTACAGAACACAAGCTGTGTCGCCGCCGACTGTAACGCGATGGCACTCGG
CAACGACACTTACTACGTGTCCACCGCCTGCAACATTTCCAGTCGGTTCGACCAGGCGGCCCAAGTTTTTAATGAATTCAATTATGTGGTCGTCGAATAC
TACGACACTGGCACTGGTTGTCAGAGCCAGAACCTAACGGAGACTGACGCGTTTCCAGCCTCTGGGAGCTGCCAGATCGCCTCTTCAGTCGGGACTACTT
CGGTTATCGCGAGCCTTTACTCGAACGGGTCACTCACCATTTCGTACTACAACGACAGCTCCTGTGGAGGTCAAAGCTTCTACATGTTTGCATTGGACAG
CGCTAATGTCTCGAGTGGTGACTGCATTGATGGAGGGTTCAAAGTATATTCCAGTGCTAGTCCTAACGGCATTTCCGACATTGCCTCAACGAGTGGATCA
AGCGTTCCCAGTTTTAGTAGCGCCAGTAAGAGCGCTAATGGCATTGGAAGTGGCGTCGGTGTAATTATTGGCACCAACACAGGGAGCTCAGGGATAAGCA
CAGGAGCGATTGTAGGCATTGTGATCGcggtggtcgtcgtggtggtgcttgtcgtCATTGGTCTTCTGTGGTGGAGACGCCGCTCAAAACGACCGACTCA
GTTTTCCGGAGCATACGTACGGGGTGATGATGTGTCTCCGACGTCAGGGCAGAAATCCACAGTCTCGGGTTTTACAGGGACCGATCCCGACTCGCTTGGG
TTGGGACCGCGCAGCTTAGCTGGACTTTGGGATGACGAGTTGATCGCAACTGCTCGGATCCCT