Description :
From Genome Similarity Track
Location :
contig_27:658215- 662784
Transcript NameFunction/comments
g7412.t1hypothetical protein

Sequence
4569 bases(100 bases per row)
GCGGCGACTGCCTGCGCGTGCTGCGCTGAGTCTCGTGCTTCTGCTGCTGCTTTCCGGCGACTGCAGGGCCGCGGGGGACCTCGTGGCGCGTCTTTACGCG
CTGGAGACGTCTGGCAGCTCCGCGAACAGGCTCTCGCTCAGCTCCAGCGCGCTGCCGAGCGCTGTAAGTAGCAGACTATCCAGCTTTTCGCTGTCCTGGA
GCGACCTGCCGGGGCTCATGCAGCGCGCGCTGCTGTGGGACTCAGGATTCGTGTTTGCGTCGGCCGTCGACGCCTCGTCATCAAGCACAGGGGACACGAA
ACTCGTGCAAATTTACACTTCGTGCGGCCAGGGGATGGGCGATTTGCTGCCGGACGTGGAGGAGTTGCAGACGCTGACGAACAGCAGCTGCAAGCTGCAA
AACTGCGGGATTATCGGCCATTTCCTGCCGGAAAACTGTCCGGTTAAGCAGGTTTTGCCCCTTACCAGGTGCGCAGTGTACGCGTCCGCTATGGACACAC
AGACGCAGTTTGCAGGCGTGTTTTGGGCCCAGGACGGACGCAGCACAGTGTCCCTGAACCCGTGCTGAGACGGCATTCCCCTCCGGCGACGCAGCCGACG
GACTCGCTCTTTGCAGTGCATTTGACAGACGCGAGCTTTACAGGGACAGACTCATGCCAGCCGCTCACGAACTTCATTCTGCCGTGTCGAGGTGTGGCAG
ATGACGTGGATATCTCCAGTCGTAGTGGGAGTGCGAGCTTTACAGCCAATAGCAGCAGTTTTACGGAGATGGACCTGTGTCCGGCCACGGAAGGAGCAGC
TATGAACGCGTGGCTTGAGCTGCAGTCGGTTCCGTCCCCGGGGACGCTCTCCACGACGGCCATTGTGCTGCTGGCAGTGTCTATGTTGATTTGTGTGGTG
TTGGCCATCTCGGTGTGGTGGCTGAGCCGATCGCGGGCGTGGCTGCAGGACGCGTACGACCGCGTCATCTTGGAGGGATCGTGGGACGACGGTAGCTGGT
CGCCGACGTCACATTTACTAGGGGGCCCACTCGCTCCGTCTCTAGCGGTCGCAGGAGCTACAGATGAGGAACGACTCACGCCCATGGAGGTTTTCTTCGG
AGCACGACCGAGAAGTCGACGGTCACCAGGGATTCACGGCACTTCAGCACTCGTAGCCACGACACGGGCCGAGATCACGCTGTCCAACGACCAGCTGTGC
CGCAAGAGCGCTATCTTGCGCGCCTTCGTGTCGGATCCGGCCATCGTGACTAAACGCATTTCGTTTGCGCAGCTCCACTTTTTGAGGCTGCTCGCCAAAG
GAGGCAGCGGGGAGGTGTGGCTGGGCCAATATGAGACTCGCTACGTGGCTATGAAGTGTTTATTGCCAACGAAGCGAGAAGACCCAGAGGCCTTGGAGCA
GTTCGCAGAGGAGATCAGGATGGCGTCGTTTTTAGCGCACCCGCGCATCGTGGCCTTCTGCGGCGTAGCCTGGCAGTCGCTCTTGCACCTTTGTGCAGTG
ACGGAGTACATGCCACGCGGTGACCTAGAAAACCTGCTGGCAAATCCAATTGCTCAGAAGGAGCTGAGCTGGAACAGAGAGAAGCTCACGCTGAGCAGTG
ATATCGTCGAGGCGTTGGTGTACTTACACTCGCTGGTGCCCATCGTGATTCATCGCGATCTCAAGTCCAAGAACGTGCTGCTGGATCGGCGATTACGTGC
AAAGCTGAGCGACTTCGGACTGAGCCGCGAACGATCCGTGGAGGACACCATGACCAACGGCATTGGCACGATCTTGTGGAGTGCGCCAGAGGTATTAGAG
GGCAAACGCTACGACGAGAAGAGTGATCTGTTTTCGTTTGGTGTAGTGCTGTCTGAGATCGACACGTGCGCGCTCCCGTACGGCTTCAGCCGCCACGCCA
AGATGCGCAGTATGCAGGTCGTCCACCTCGTATCCGAAGGCAAGCTGCTTCCCAACTTCCGGGACGACTGCCCGCCAGCAATACGGGCGCTCGCACAGCG
ATGCCTAAGCTTGGACCCTGCAGCGCGTCCGACAGCAATGGAAGTCGCCTTCGAACTGCGCTCTTCCATTGCTCCCCAGCTACTGCAGCAGCCGATGACG
GCACTGTTAGTAGCGGACGATGACGGCGCTGTTAACGTTAGTAGCGCGTCAACTCCCCTCACCCAGACGTCTCCAGCCTTCACAGCAGTCGAGAACAGCT
CGACGCCACCTGTATCATCATCAACCGAGACCGCAAACACGAAGGAGACCCAAACGGATCCGTGATCTTCAAGACGAAAGTAGTCGCCAACGGTTAGGAA
CGCGAGCCTTGGCAAGTCGCGTACAGACCAACGGAAGCCCATTAATTTATGAGAACAAAGCTTGTAAAAACCTGAGACCGTCGCCACCCAGCAATAGCCG
ACTGAACATGCTGACACTAGCGAAACGGACGTGATCACTGTCTCGGTGAGCCTCTGGATGTGGAGGTGTGAGACGTGGGTTTCCACACATCGACAGCGCC
ATGGACAATGACCATGAGCCATCGACCTCTAGGGCGCGCAAAGCCCTACTACTCCGTCGAGTACCGATCCTGGCACATGTCGTGAAGCAGGGACTGTGCT
CGGAAGGCGAGTTGCTGCGTGCATTGGAGTACGTGACGTACAGTGACGGAGAGTACATTTATTGCCAAGGCCAGCCGGAACGAGACTTACTATTCATCGA
GGAAGGCAAAGTTTTGATCACTCAGCGTCGGCGATCTCGTGCTATGAGCACTACAGGTAGTCGCCCGGTGGGGTTTATTCCGATGGACAGCTCGGGCGGT
GTTGTATCCTCTCGGCGGCCCTCACGACGGCGCTCGCAGATTGAAACTGAGATGGAGATCCAGCTACACAAGCACGAGGAGCTCGAATACTTTGGCGAGG
AGTCTTTGCTGCAAGGATTGGTTTCTAGAATACTCAATGCGGTGGCTAGTGGAGCGGTGACGTGTGCCGTACTCCCAGAGGCTTCATTTGCCAGGTTGCT
GGCACCGGTACACGAGTTAATGCTGCATCGGCATTTGTTGCGAATGCACGGCGTGCTGGCAAAACAGCGAGTATTCCAGCACTTCTCCGCTCGTCAACGA
CAGCACATTTTGGATCGTTGTACTCTAGAACACTACGAGGAAGGAGCTCGAATCATTCAGCAAGGTGATAAGATGACGACCGGTATTTTATCTTGGCCGA
AGGGGAAGCTGATGTTGTGCTAGATGAGCCCTTGCGAGATCTTCGGCCAAATAATTATGCAGAGGGGATTGAAGGGTTTGAATATGGCGGAGAAGAAGAG
GACGGTGGGGGCAGTAGAACATCGATTGTGTGTCGAAAGGCGCTTTATCAAGGATTTGGCGAGATGGGGATCTTAGGCCGGCCTCGAACAGCGCATGTGG
TTGCTGCTGGGAGCGTGGTTTGTGCAGCGATTTCGCGAAAGACGTACGTTGGCGCTTCGCAGTTGATAGGCGTTAGTGGCGTTGATACGGACGCGGAGGC
ACTGCTTGCTATGTCTCTGATGGAGGAGTGGGCCCTTGTGGTGAAAACTCGGAGCCTCCATTTGGCGAACCCGTTGGTGTCTCGACATCTTGAAACCTTT
GTGAAAAAGTTTAAGGCCGCCTACATGCAGAAGTTTGAAGGCAAAACGCTGTATCTAGACCTGCTCCGACGAATGCACGCAGAGCCTTCACTTGCCGATG
AATTCCCGTTCGTGTCGGACCGAGTGGCTTGGGATGCACCAACATCATCGCTCAGTATCACGCGAGCTGAGACTCGACGCGTGCTACTGCTGCCTCCGGC
TGACCGCTCCCCGTTCGAGATCAGCTTCATGGCGCGCTTGCTCGAGCCTACAGCGTTCATTGGGAAGTTTGACCGGCCAGCTCATGTCGATCAGCTCACG
CTCGCTCGCGGGATCGCTCGATTTGCCTCGTTTGCCACCATCCAAAAGGACAAACACCTCTTTCGTCAAGGCAAGATCGAAAGCCGCGCCTTCCTCATCT
TGCGAGGCAACATCAGCATCGTGAACGAGGACGTGAGCACCATTCAGACCGGTCTCGCCGTCAAACACTACGACGTACTCGCCACACTCTCCGCCGGAGA
CTCATTCGGCGAGCTCTCACTTGTAACGCGACTCCAGCGTTCAGCCACAGCTCTGGCTGCCTGTGAGGCAGATTTGCTGGTACTAGAGCGTCCGCATTTG
CAGGCCTTGATGGCTCTGCTACCAGGCGTATCGGTGCAGCACGCCATGGTGGAGCGCGCCGAATTCCTTGCAACGCTCAACTTTCTCCGGGACAATGACT
TCGCGCAGTGCATTCGCGTGGCGCATGACCTCCAAGAGCAGTTCTACGAGCCACGCCACCTTTTCCTCCAAGAACCCGTGCACTTGCGTACGCTTTACAT
CGTCAAGAGCGGCGAAGTAGTTGTGTTTCTGCGTCGGCACGTGCCAGTTGCTGAGACTACAGGGACCTCAGGAGCGAATGACGTCGCACCGACCAAAGAA
GTGCTTGTCCGAGTGGCAACGATTGGACCGCAGGAGTTTTTCGGTGTCGCCATTGCCAGCGCCAACATG