Description :
From Genome Similarity Track
Location :
scaffold_16:65817- 86731
Transcript NameFunction/comments
g950.t1 hypothetical protein PHYSODRAFT_343758
g951.t1 hypothetical protein PHYSODRAFT_309120
g952.t1hypothetical protein
g953.t1 hypothetical protein PHYSODRAFT_551943
g954.t1hypothetical protein
g955.t1 hypothetical protein PHYSODRAFT_248383
g956.t1 ferric reductase, putative

Sequence
20914 bases(100 bases per row)
ATGTGGACAGTCGCGCCTTCAACGCCACGACTCGAAATTTGTTGCTGTCCGTCAGCGCTAGCAGAGACTGAACGCTCCGCTCGGCTCAGCGAAGAGGGCG
GACCAAGTTGCCGCCGATGAACACGTGCTGCGATGGTCGCAGCTAACGGAGGAAGTTTCGATTGCGAAACCGCCGTGAACGGGTCTTCAAAGCAACGAAC
AAAGCTTCAGGTGCTGAGCCCTTCTTGAACCAGCATGCTACAGACCAAATACTTGCCCCGTTCTTTTTTGGAGGCCTCGTTCAGTGAGCGGCTCACGTGC
ATGCGCGAGGCTGACCATTCTCTATGCTGCAACATCGTGGGACCTGCCTTCGTTGCCTGGCTCCACCGAGGCCCGATCCCAACGCTCGGCTTTCGAGCAA
ACGACTCGACTGAAGGTCAAGGTGCAAGTGGCAATGGACCTCGCCAATGCTAACCGGTACAGCTTTGTGGCCGACGGCACATCTTGTTCCTTCCTTCTGC
ATCAGACGCAAGAAATGCAGCCGTGGGGGATCGGCACGCACTTCTTTTTTATAGCGATGGAGGATTTTCCTTCGCTCTGCTGGTGCAGGTTCAATGCTGC
AGTTTCACCACAGGAACGTGCAGTTCAGCAGCGCTCGCCTGTCTGAACTAACGCGGCAACTTGTGTCAGCGGGTCCGCAGAGCCCAAGCCCCCGGTGTCG
AAACCACATACAAACCCCAGGTGGTTGCATCCTTTGACGGCCGACAGTGTCGGCGACGCTGGCGTAACTCTTGCGTGGACGGGCCAAGAAATTGTCGCGG
TTCGACACCATCCAGCCGGAGCGCGGCGCCACACTATCCAGCGTCCGCACGTGGCGACGCAGTCGGTATTTCCAGCCAACCGCCCCACGTCGCTCCCCGG
AGACCGACGTACACACAGCCTGCAGTCAAAGCTCTGCACGTTGTACCATACCCCGCCCGTCCAAAACCAGAGGAAGGAAGCAAGGACTATCGCACCGGAC
CCCTTCAGACTGCGAGCCATTTAGCGTAGCGTAGCGCAGACCGACCACAGGACGGCAATGAACTTCCAGAGCGGCGTACAGGTGTTCATCCCGGCGGCGC
TCAACCGACCCACGCACACGCTCTACAGCATCTGCATGCTGGTGCAGCCCACCAACCAGGAGTGGACGGTCAACCGCCGCTACTCGCAGTTCCTGCAGCT
GCGCAAGGACATTCAGCACAAACTCGCCACGCGCGGGGTATCGTGCGCCAACTGCGCCAGCTTCAACCGCGCCATCAGCAAGTTCCGCTTCCCAGGCAAG
TCGCTACTGCGCACCAACTCGGTGGTTCGTCACCGCGTTGCAGCACTGCAGGACTTCCTCAAGCTGCTCGTGGGGCGCGTCTACAACGACCTCCCGAAGT
GCGGCATTTGCGGAGAGGAGATCAAGGATATGATGCGGCCGTTCCTCATCCGAGGAGCTCAGCCCATGAACGGCTCCATCATCTCCAAGATCAACAAGTC
GCTCTCTCTCGAGTCGTACGCAATGGTGGATCAGCCGGTGATGCCGGTACCGGAGCCGGCCCCGCCCATTTCGCCTTCGTTGGCCAGCAGGGAATTGTTC
AGCGCCAGCAAGTCGTCGAGTAAGCCCATTTTCACACACAGTCAGATTTCAGGCGGCAAGTCCATCTTTTCACAGAGCAAGGCGATGATGAGTATGAGGT
CGGACGATGCGTCCACACAGCCGAATGAATCGGAGGACCCCATTATGGATTACTCAGACAGCGATGACGACGGCTACGGCAAGAAATACGACGATCAGCG
CTGTTACGATGAGGGTGTTCCTCTTGAGGAAGCTATGAAGCAGGTGGTGGTGCCCAAGGGAGCTCGTCTCACGTGCGAAGAAGTGGTTGTCCGGCTTACG
TCGATGTGGGCCTCGTACGACCTGGATGAGGCGCTTTCTTCCTTACCACCTGATCGGCTTTCACAGCAAGCCCAATTCTCTGTTGATGACAAGGAATACG
CGTTCTAAGTGTCATGTTGGATAGTGCAATTTTGCTTTTTTCCTCCTCGAGGGGTAGCTGCTAGCCGGCCAGCAGAGCCGCATCGCTCCATGGGCAGGGT
GTTGTGCAAAACTAAGTATGAAGCAGTCAGTATAATATCAATGCGACCAGCACACATGGGTCATCAACAATCATATTCTTCTGAATGGGACATCACTAGG
TCATTGCTGATTCTTCCAGACGGCATCCAGTCTCCTGCCGGCCATTACTGAGCTTCTATAACTTTTCGGGATCCGCGATGCCTGTGGCGACCACAGAGAC
ACGTAGCTTGCCGTCGAGCGAGTCATCAAACGTGGAGCCGAAGATAATATTGGCGTGCGGGTCGTCCAGTTCCCGCGTCACACGCTCTGCAGCTTCATCA
ACTTCGAAGAGCGTCAAGTCGGAGCCACCCGTGATATTAACGATCATGCCCTTGGCGTCCTGTACGGCACGTAAAGCAACGAACGTCAGTAGTGATAAAT
GCACAAAGGTAAGAATTAGATGCAGTACCTTAATCGAAATGTCTCCCAAAAGTGGATTCGCCAACGCATCCTCAGCAGCACGGAGAGCACTACATGACAC
CCCGAGCACAAGCAAGCGTTAGCTGAATCAAACCCACTTAATAAGCAGTCCGTTAGCAACTGTCAAACCCACCGGTTGTCTCCATCAGCTTCTCCACTTC
CCATCATGGCGTTTCCCATGTTTTGCATCACCTACAGTTTCAAGTGTAAAGAATTCAGTGAATAAAAAATATTGTCAACAAGTATGAACCGATAGAAATT
GCGTACCGACTGAACGTCGGCAAAGTCGAGGTTGATCAGACCGGGCATCACCATCAGATCGGAGATGTTCTTGACACCGTCAAGGAGCACATTGTCCGCC
ATTCTGCGCAATAAAAAAATTGGTCATGTAAGCATTACACTTGTGCTGTCTGACCTGCTCTCAAGTACCCCAAGCCACGCACCTGAAAGCGTCCATCAGT
GAGGTGCGCTCGTTCGACATATTAAACAGATTCTGGTTGGGGATCACAAGCATCGTATCCACGCTATCCTTCAGCTCAGCGAGCCCCTGCGCCGCGAGCT
TCGCGCGGTTGTTACCCTCAAATCGAAACGGCTATGGCGCGTATTAATCGAGGATGTTAGAGACAACGGCGTCGAATGAATGATGCTGTACTGTGGTGTT
TGCATACCTTGGTGACCACTGCCACGGTGAGAATACCGGCGTCTAGCGCTGCCTGGGCAATAACGGGGGCTGCACCTGTACCAGTTCCACCACCCATGCC
TGCTGTAACAAACATCTACATAGCGACAAGAGTATGAACAAGTCAGTAAAATTGCCAGCATTACGAAGTTTCTTCGCTTCAATAGGACTCTACAACGCAC
CATATTTGCGCCTTGAACCCGCTCCAGAATCTCATCGATCGCAGCTTCAGCAGCTTCGCGGCTGTAGTAAACCGACACATCGATCGCAACAAACCACAGT
TCATCACGTTAGATTATTGAAGCCGTTGCCACAGCAACAAGCGAATTACTCACCCCACTTCGGGATTGGCACCACAGCCCAGCCCTCTAGTCAGATCTGG
AGCCATCTGAACGCGGTTTTCCGTCAACGTGGTGCGCAAATGCTGAGCGTCCGTGTTGCAAACCATGAACTCCACACCCTGCAGGCCGCGCGCGATCATG
TTGTTCACTGCCAATAAAGTTCATCAGGTAAAGTCCAACGCTAGACCTCGTTCACTTATCAATCAAGTCCACACACCTGCATTTCCTCCAGCTCCTCCGA
CACCGACCACCACAATCTTTGGTGCAAACCCTGACAAGTCTGTCACAGGGAGGTCCTGCGTTAGCCACAGCGGCTGCGTGGAGCTCATCACCGGCGGCAC
GAGCTTCTTCTCGACCACTGGAGGCGGAACCGCGCTTATATCTGTCGGAGATTCAGGCGCCATCTCCACTTTCGGTGCGTCAGTCTCGTCCTTCTGCGCC
TTCTTGAAGCCCTGCAGTAAGTGACGAGTAAACACTGTGTTCATGTAGTGCATTTCATTGGAATGCGAGACTTTACCATGCGCAACGCGGCAGCAGCAGC
ATCAGTGGCTTCGGTAGAGAAGGAAAGGTGCTGGGTAGCGCCCTGGGTGACGTGGCGCGCACGCAGCAGCGCTGTCGTTACGGCCTTCATGCGGGAAATC
GCCATCGGGAACTGGATCGCCACAAAATGATGAACAAGTTTTTAACTGATATTATAACGGATATGATTCGTTAGATAGAATATATTCCCCCGTAACTTAC
GATGTATTTTATTTCGCGACCTGCTCTTGCTGACGAAGTTCCTCCACGTTGGCCTTGATGTACAGCAGCACTTCTGCCTCGGTCAGGTCCAATTGAATGC
CATAATTGCGGCCCACGAACGTGCTAAACTCGTCGACGTCCGAGCACAACAAGCGTCCGGTGTCGGTCCAGATGACCACGTCACTGATCACCAAGTTCGA
CGAGGTGGGCAAGTTGAAGCTGTTTCGGTGCGCAGTGATAAGTCATGAAGCAACACGTGAACACTACAATGCAAGCTTACCCGTATACACGCATCAACTC
GGCTGCATCGTTGGGCCAGCGGTCGGCTCTCGATGGGCGCTTCGTTATTTGGCAGTCGGGCAAGGTCTCTGCCAGAATGTCTTCATGATGCCACAGCCAC
CGTAAGTAAAACCAGCTACTGTGCATGTACATGTATGGATAATGTCACTTCCTACCAAGCAATCGATCGCAGATAGCGTATTCTTCGCTGCTAACTCGTC
CGGCTAGTGTGTAGTGCACCATTCCGATTGTGGCAATGCACGGCTGGAAAGCAACCGCGCTCAGAATAGATAACACGTTCAATATGATACATGTAAGAGC
TCCTTTGTTTGAGCACAAGACGGTAGTTGAGGTCCTGTTCGAAGGTTGTAAAGATAAATTCTCCTTACCGGTATTCTCCTTTTTTGCTTCGTTCGAGAAT
ATCTTAGCGACCTACACATTCGGTACGAATAACAGTGGATATGATGGCGAGGGTCTTACGAATACGAAGGTGCAGTGCTCTGGAGCTGTAGCACAGCTGG
ATCCAGCTGTACTTGAGTCAGATTATCCGACAAATGGTTCGTATAACTCCTATCCTTGTCTGTTTTTCTTGTAGAGGACGCCGTCCCCAATGTCTCTTCA
ATTGTCATGTTCAACAAGGATCGGACGATTGAGTTATCGTAATCGTTTACTGTTTTCACTTGCACCCTGAGCGCTTCCTCAATTTGAGAACCTCAAAACA
TGAACTCCACTCCACTTTTGCTGACCGAAACGCACCCCAACTCTCAAGCCCCATCTCACCGCACAAACCAAAGATGAACCTCAAGTTTTGCGGATTCGTG
CTTCTTAGCGCCGTGGCTGCCACTGCGCTGACGTCGGTTGATGCTGAAGACTACCCTGGATACTGCTGGCCCCAATACTGTGGTGACACGAACTCCCCGA
AGAGCCAGGCCGCCTTTCAGTGCTGCAACGGCCAACGCTACTTTGCCAGTTGCTGCCAGAATTACTGCAACACTGGTAAGTGCGTCAAGGGAAGCAACTG
GTAAGGATACGTTCGTCGGAATGGCTTCTTTACGAGGTCTTGCTCCAACGACAAGACAAGATTGCTGTAAGACCGCTGTTTTAAAAGCGCAAAACACACA
AAACTTACCAAGGTACACAACGTGTTAACTGTAATACAAGTTGCATCTAGCATCCTCGCCGCAATCGTTCAAGAGCATCGCCGCTACTGTTGCACCTGGT
CATTGGCATTCGCATTCTCTCGACGCTTCTTGGCTTCAGCACCAACACGTTTGAACTTCTTGCTCTCTGTCTTGTTCTGACCGCGATACTTTTGTTTATC
CCAACGAGACATCTGTGAGGAATCCCGGCAACCAGCACCGCCTTCCCAGTGACGAGAGGTCGTCCTTTTCGCTGCGATGTCGTTGCCACAGGAGCACACC
TTAACCGAGCTCGATTGTTCCTTCGAGCACAGGCCGCATATCATCCGACTGGCGAATTTTCCCAGGTTAGCTTCGGGGCAATCACTCGAATCATGGCAAA
CATCGCACGGGAAAGCCTTGCCACAGCACTGGAAGCGAAACCAACGAAGCGAGTGTTTGTAGTGGTCGCACGCTCCGTTGCGAGGCAGCGGCTGCCCCAA
TACAAATATCTCCGCGACTTGTTTGCCACCTTTCTTGCGGCTTGCTCCCTTTTCTGCTGTACTAACCGGCGAGTTGCTTCGCTTTGCGCTTGATTCATCC
ACTTGGCCTACCACAAAGCGCTTTGCCATCACAGCAAGCTTGACGTGGCAGGAAAAGCACGCTTGTTCTGACCGCTGCCTCGGTCGTAACCTCTCCAGCA
AAGCTTCACATCCGCACTCCAAGCAAGTAGCCAAGACATCGGTGGGGAGGACGTCGACAATGGCGCAATTCTCGGTGTCTACAACAGCTAGCATATTGCT
CTGCGAATGGGCGAACAGGGGCCTCATAAGCACGTGATGAAGCACACTGCAGCGAGGGCACCATTTTTGAATTTCCGGCGAGTCCAAACTTAAGGCAGCG
TCGAAAGAGAGCGGGCAGTTAACACACTGGACCTGGCAAACGAGTCGATGCGCAACAAGAGTACCAACTTGATGCAGGAATAGGTCTTCAAGGCAGATTG
GAGTGCCCTTCACTCCGAGCTCAGTTTCAATGGTAACGCGCTTATCAGCAGGTATAATGCTTGCATGTTGAACGCGATCATCGCTCTCCGCTTGTTCCGG
GGCTGCTTCTTCCTCCTTCTCCTCTTTCTGTGATACGAGAACGGTAGTGGGATCCACGCCACGCCGCACCAGCTCACACAGCATCTTGAAGCGATCGATG
CATTCATTCAGAGATCGACCATCGACCTCGTTGGCAATGCTGGTCCAACGTTCCTGCTTGTCCATTGAAGCTGGGTATTTCTTCAGCGCCAGATCGAGTG
CTCGCTGCTGCGTTTCCGACCACACTTCGCTATCTTCACGCTTCGTTTCAGTATTGGCACTATTAGAGGGCACTGAGGTACTCTTCACACCTTCCACCCC
TGTAGCTACATCCTTTTGTACAGGCGATGGACCCAATTGTACGACGACTGCACGTGGTGAGGTGCCAGCCGCTGGCTTCTGTCCCTTGGTATTTGCTTCG
GCATTCTTGAGCTCGTGTGAAAACTTGCATTTATCTCCGTCGCGACACTTATTTTGTGCGAAAAACTTGCATTTGCGAAGACGGAGCTTCTTTTTCTTCT
TCGGTTGTGCCTCCGGTTTTGCAGATTCAGGTGGTTGTGCCAGATCAGCTTTCCGGACAGCGTCTGCATCACTAACTCCAGGCTTTTCATCGCCGCCTTC
CATGCTGCTTTTACTCGCAGTGTGCGAGAACTTGCACTTCTCTCCATCTCTGCAGTTGCCTCGAGCGAAGAAGCGGCAAGGTCGCTTGCCACGTCTCCTC
TTCAGTTTCTTCTCACTGGATACAGCTACAACTTCAGCCTCAGTCTCCTCAGTAAAGTACTTACCGTCTCCTTCTTGTACCTCCAGATCTTCCTCCAAGG
GCGCAATTGTCCTCCAGAAATTGTTGTCGATCCAAGTCAGCAGCTTCCTCAGCGAGAAGCCTCCGCAGAGCTGCTGAGCTCGTGCATTTACTGCCGTATT
CAAAGCTTCAATTTGCTCTTGTGATAGTCGACTACTCCATTGCGCAAAGTCCACATGAACAGCTTCCACTGGGTATTTCCCAGGTAGAGTCATTTGCAGC
TCCACTTGGCCTTTCAGTCGCGTAGGTAGTTCCGGATCGGACAGACTCAAGAAGAAGCGCACGTGCTTGTCCAGTGTTGCGGCGTCTTCACTGATCAACT
GCAGATGATAGCGACGTTCCAGCGTCATCCATTCCTTCTTGGAGGCGTCTGTCTCGCTCGCTAGAGCCTTCTGCCAACTTTCACCTGCCATCTTCGTCTC
CAATTCCAGAATAGAATCAAATGTGAGCTTTGAAAAAGTGTCACAATATTTTACCGGAAGTTATTTTACCGGATATAAAGTTCTGAGAATTTTCGGTTCG
GAGCTCGTAATTTTACCATGTGGAGCATCCGTCTACGAGGACCTCGCAGCAAGCAAGTGGTGCTGAAAATTGACCCAGAGGCCAGCTTCAAGACGTTCTC
AGGTTCGTGGAGCTGGTGCTGCTCTTACCGTGTGTGTGTGTGTGTGCATGTAATTAATGGCTTTGTTTCGCAGAGCTTGCAGCCAAGGAGTTGGGCCTGA
CAGCAAAAGACTCACCCACATGTACTTTACGTATCTGACGGTGCAGTTATTTGGTTGCTAATTTATTGTTGCGTGCTGCAGTTCGCAGAGGTTTCCCTCC
TCGGCCGGTGGAAGTGGACAGCTCGGCACTCGTTAAATTCGTCTTCGAGGCCAATGACACGGTGGTGGTGGACACGAGCTCCTGTGCTGCGGCCCCAGTA
CAAGCTACTCCTACGAAGAAAACTGCAGGGAGACCAAAGCGAGCAGTCGCAAAGAAAGCTGCAGCGAAAGTACCAAATGTCGGAGTACACACGCTGAATC
CGCCGACAAAAGCGACGAGAAAAGCGCCTCCGAAACGGAAAATCACCGGCAGTGGGCACCAGCTCGGCAGTTCACTGGAGAATAACGCGTCTAATGCTGC
AGAAGCTATAGGGGAAGACGAGGACGAACCCCAACGCAAATACCGTCGAAGTAAGGCGATTAACCTTACGTCCAAGGAAGATGTGGAGATCAGTCTGGTG
AATGCTGTCAGCGGCCAATCCAACGATCGTGCAGCCAAGTTCTTCCGAGCGGCGACAAAGAACGCAGTGGAGCATCAATATGAGCTGACGCTGGCAAATG
CGAGGCTGAATGCTGCGTTGGCGCATAATTTTGAGATTAAAGAGCTTTCAAGTGCGCGACGCGCTGACGGCAGTGCTGCTAAGCTACACGTGCGCTTCAA
GGAGACGCCGCGCAAATGGAAGGAAGAGACGGTTGATTTACTAAAGGTGGACGAACTACAGGCAATTTTGAAATACGTGCTGCTGTCAGGTGGTGAGACT
GGTCGTGAGATGCTCAAACCATTCAACATGGCTCAAGTATCTATTAGGGTGTTTTGGAGCATCGCGCGCTTGTATGATGGAGATGTCGCTGCTGGTCTAA
CTGACCTTGTACCCGATGAAGACTGGTCGTTCATTGATACTCGTGCGCGGTAAGATTTTGTAGCTTTGTAGTGTACAGCACGAAGGCTAACCTGACTGAT
CGTGTGATGTTGGTTCGTTACAGAGTGATGTCTGAGAAGGCTATGGAAGCGATGGTAAGGATCAGACCGCGTCAGTTTTATTGCAGCTCTTCTCGATTGA
ACTGATAATTTGTGCCGTGTTGGTCTTTTGTGTAGCAAAATGAAGAGCAGTATAAGCTGTGGAAGCAGGGAAAACAGGACGATACTCGGAGCAATCGTAC
GTCTTCTTCGAAGCCAGACAGCAAGAAGAAGACAAAACCACCAAAGCGCTCAGCAGCCAAAGAGACGAAACCCGAAATCATTGACTTGGACTCAAGTGGT
GAAGAGGAGGTAGAGCAGACTCCCGCTCTTTCTGCGAAGGAAGCGACCCCCAACACCCTGCGTAGTGCAGCTGCACAAGCTGCGCTAGCTCGGCTCGACC
GAAACGCGCAGACAAGTGCTGTTGTATCCGCTTTTCTTCGAGAAGAAAAATCAGCTTCGACATCGCCTGTTAAGAAAGAAGTTATCGTCGACGAGGATGA
AACTGAGTCCGAGGAGGAAGTGGAGGAAGCCACTACGGTGTATTGCGACTCTTGCAAGAAAGCGCGCATCCTATCGCCCGAAGAAGCTGAAAACGCTGAG
CTCGACAAGGACCCATGGACTTGTGCCAGTTTGGCGGGAACAGGACGTAGCGGTGGATGTGACGCTATCGACGATGAAGTTGTTCAGATCACAGGCGCAT
CCATTGCTGAATACCTGCGAAAGGCTGCAATCACCACTCGACAAAAGCTAGCGGACGCTTCTGTGGGAGTTACCATGCATGCTCTTGTGAATCCATTGGA
CCCTTCCGCTCAGATGCTACAAGAGAAGTTCGAGAAGCTGATTGAAGAGGTACGTTTGTTTGTCTGCACTAAGCTGTTTTACTGGTATCTGGCTGATGGG
TGCGTGTGTTAGGCGCGTCTCGATGAGGTGAACGATATGATACTGGAAATCGTCGGTAAGGCTGAAGTAGTCGGGCGGCTTGAGGTGCAGAAGCTTGGGA
CACCTGCCGATTTGATCGCCACACCGAGCGACTTGATCCTCGACGCTGTTGGCGGTGAAGCTGATGTTTCTCTCGAGGTGGTCAACTCCTGGCAGACCCG
TGCCAAAGCGTTTGTGGACGATCACCCCTGGCTGGCGGAATGGCGCACGCTATAAGGCTCGAACTTCTTTGATGAAGCATTTCTGATGGAGTAAAAAGGC
ACAACTTTGTTGCTCGCTACTTCGAAGTATTTGAAACCGAAATGAAATTTATTGCTCTTCCGCTTTCAGGCATTCTGTTCTACACACAGCAGGCAAGATC
GACTCGAAAATGACGCATTGCTGGGGCTCCCACTAGTTCGCTCCTGATGGTAGCTTCCATGACTTTCAAGTCCGTGTATCGCCCCCTCCCTTGCCGCTTC
GCCGCTCAGCACCTCGCGGCATTACGCTGGTGACTGGAGCCTTGAATTGCTAACTTGGTGACTTCTTAGTCGATCTTAATGGAGCTGTAGATCTTGCGAG
TAAACCAGAGGCACGCGAAGTAGCCGATGGTACCCGTGAGGAAGAAGAAAGTGACCGAAATCAGGAACATGTAGCCGAAGTACAGGATACCAGAGACAAA
GGCCGTGATGTTGAGCTTCGTGAAGAAGTACAGGAACGAGTACAGGAACAGATACACGGCCGCAGAGCCCGAGGTGAGGAACGAACGCCACCACCAGCGG
TAGTCCTCTGCGCAGAGCTGGAAGTAGCACATCACAACCGTCACTTCAGCGCACGTGGCCACAAGGATCAGCAGCACAATGAACAGGAAGCCGAACACGT
AGTAAATCTGGTGCAACCACAGCGCCGACATGATGAAGAACAGCTCAATGAACACGGCGCCAAACGGCAGGATACCGCCCACGAGGATGCTGAAAGGCGA
GGACAGGTACCACACTTGCTCTGGGATCTGGCGAGCGATCTGGTTCGTGCGCACGGGCTGCTCAATGGCAGCAGCCTTGAAGCCAAAGTAGCTGCCCAGG
AAAACGAGGGGAACCGAAATACCGAACCACAGGACAAGCAGAGCGAACAGCGTTCCGAACGGGACGGCCTGCGACGAAGACTTGCCCCACAGCACCAGGT
TCAGCAGGAAGAACACCGCGAAGAGCAGACCCGGGTACAGCACGGCCGTAAGAATCGTGTTCTTCTTCCAGTCCTTGCCGTTGAACATCTTGTACGTACG
TGACGAGTTGTAGCCGGCGAAACTACCCATGAACACGAAAAGCAGCAGCAGCGTCGTCAGAAGCGAACCGCGGTTGGCCGGCGACAGTAGACCCAGCAGC
GCAATAACCATCGTCGATGCGCTCATGCAGCACACCTGCACGCCTGTACCCACAACCACCGAAAAGAGCATGGGCGAAAGTTGAGGCGGGCGGAACACGT
CACCATGGACAAGCTTCCAGCCGGACTCCTCCTGCGCCTCCTCCGTGGTTTGCACCTCGTTGTAGCGGGCGATATCACGGTGGAGCGTGCGCAGCATGAT
CATAGCAATCATACCGGTCAGGAAAAGCACGATCATGAGCGAGTTGATAATGGAGAACCAGTGAATCTGATCGTTCGCGCTCTTGCTGCTGATAATACGG
TCCCAACGCTCCTCCCAGACGATATCGGACTTGACAAACTGCACGTCGTACGTGTACAGCACGGTGGTCTCACCCTCCGGGTTCAGGTACTGGTAGTTGC
CCTGTGAGACCTCTTCAATGTTGACGAACTTGCCGCACGTGTCCGAGTCCAGTTCCTGTCCAGCCATTGGCTCGTTCTCGTAGCTGTGTTTGATGGAAGT
GGGCACCACCTCGAAACCAACGACGCGCCACTTAGGCACGTCACCGTCTTCCTCGGCGTACGGATCCGCGTTGACAGAGATGATGATGCGCACGTGATTG
TACAGAAGATACTTGCCGTCCTCATCCACTTCGCCCACGGGGAAACCACGCTTGAAAGATCCAGCCTGTTGGGAGTCCGTCGGGTCGCGGTACAGCACCG
GCAGGTTGTCTACCACCCACTGCACGTAGTACTCGTCCTTGATCATGTCAATGAAGGACTGCGACTGCTCGGACGTGTAGGTCATGGGCTTGCACAGCAC
CTGACAGATAGCGTCCTTCTCCATCTGCATGTTGTAGAGGGAGTCCATGATAGCGTCGCCTGCCATGATCTCACCCAGGTTCTCCTGTTGCTCGTTGGTG
GCCGTGGGCTTGCAGAACGGCAGGTAGTAGTACTCGTACGGCACCAGCGTCTTGGTGGACGTGATCTTGTTCACGTTGAGGCGCACAGCGTCACCCGCGG
CCCAGGACTCGGGGGCGACACCAGGCACGTAAAAGGCCGCGCTAGCCTCCTGCACCGCCAGGAGCGCAGCCAGCGCCACGCTCTTCATCCACATCTTGTG
CTTAAAGGGGGGAGAAGGAGGGAGGGGGAGGAGGAAGTGATCTATTGATACTGCCGCTTGCCGCCCGACGTCTGGCTTCTTCTTGGGCGAATGAGGGAGT
GCGACTTTGGCTTGCCACGAAGCTGGCGCGAGATTACATACCCGTATAAACCGATGGATGAAAAGGAGTGTACCTGTGGGAATAGATATGGATAGTGGGA
GAGCCGAAATATCAACCAATCGTAAAGTGTTAAGACGACAATTGGACAGAAATGAGACGAATCAGCTGCCGACACCTTTTCAAGGTGTAAATGAGGTGTA
CAACACTAAAAGCACTTCACATAGTGTGGGTCACACAAACCCTCGCATTTCCGTTGTACTTTTGATCCCCTCAACAACAACACAAGAACGCAGCTCCAGA
CTTGGGGTTGAAGCTGTCGGTTCTCCTAGCGCGCCGAAGGCCAACAACTGCTCAGGTCGTTCCCCCTTTCACCTGCCCAGTGAGGTGAACGCTGACCGGA
AACCTGCTGTGCGTGACGCAACCAAGACCGCATCCCGCTTAATTATAGCAGTTGGAGGCCTTGGTTCTATTGTCGTCAGTCTTCTGCTTTGTATCCACGC
AGAGTCTCGCTCCACACACCAGTCGCTAAAGTCAACCGCCGGGTGGTGAGGTGATCGAAAGCGATGGAGGTGGCCGTTGTGTCCGAACAAGTGGTGGCCG
AGGCGCTGCACCAGCTGTACAGTCCTCTGAGCTCCCCGCGTGTGCGTCGTCGCGCCGATTCGCTTCTACAGCAGTTCCAGCGCTCACCCGAAGCTGCACA
GACGGCGTTGGCCGTGCTACAGGCGCCTATTGTCGACACGGGCAATCCGGAGCAGAACGGATTGCTGAGAGCTAAGCGGGCGTTTTCTGCGTCTACGATC
TACTTTACTGTGGCCTCGTACATCCGCAAGTACAAAATGGAGAATCCTGCCAACTGGACGCCCGCGGAGCGCGTACAGCACGAGATTTTAGTAAAGGAGT
TTAGTTTAATGGCTCAGGAAGTCTGGAATGTGCTGACGGGGGCCAACGGCACGCAGGAGGAGCTTAACGTGCAGACTCACTTGGCACTCACCATTGCAGT
CATCCTGCTACGTTTTCACGAGCCTCAGGGGGACACCACTGTGGTTGGCGCAGTGGAATGGCTAGTCCAGAACCAACAACACCCAGTTAGCGATGGTGTG
ACGGCTGCGTTGACCAATTTTGCCGTGCTGCTTACGCTGAAAGTTATTCCAGAGGAAGTGGACAACAAACGAGTCAAGTTTTCCAAGGCCAAGCGGGTGC
TTTGCGAAGACATGGTGCAGCAGTGCGCAGCCCACGTGGTTAGTACTGTTCTTCCTTCGATTGCTACTGCTATCGACGCAAGTGAGGAGCAGGTACAGTT
ACGAGGTCTGCTTTTGCAAGCTTTTGCGAGCTGGGTGGAACATGGTACAGTTCCACCGCCAGTTATCATTGAGTGTGGGCTATTGGACCGAGCTTTTCGA
GAAACGTTAGCATCTAGCTCCTCAGAGCACGCGCTACAAGTTATACTTGAAGTGGTGCGTGTCTGCCGCCATGACGAGCATGTGCAACTTATGGAGCTCG
TCATGAACAACTTCGTGGTACTTGGGAAACATACCCAAGAGCGCATAGCAGCATCAGAGAAAAGCCTGGAGTTTTGCCTTGCCAACTGTGCTAGAGCGAT
ATCTGAGTGCGGCCAAGCCTTCATCGTGTACTTTGTGGACTTTACGCTGGATATGCGAGCTGGATCTTTGGTGTATGAATTCCTGGAGACAATTCTATTC
TTTACATCGCTGAACAACCTGGACATCTCTAACGAGACGATGGAGTTCTGGATTGACTTTCGGGTGTATGTTTCGGGCAAGCACGAGCAGCGCATGTACG
CGTTCGAAACCTTCATCTCTCGGCTGTTGGTCATTTTGATTGAACGGACGCAGTATCCGGAAGGGTTTGAGGCCTTCCCGGAGGCTGCTAAGGAGCGTTT
CTTCTTGTACCGAAGCGAAGTTCGGAATGTGTTCCGTGCTCTTGCGACGGTCACAATAGTCACTGAGGACAACTTCATTGTTGATGCTATCCACGCGATC
TTCCGGCAGTACGAAGCTGTCGATTCAGGGTCTCCTTTGCCAGCGAACGTACGTGTTTTGATGTATTACTGGCTGTTGTGCTCGTAGAACTAACCATTCT
GTGTACTTGTGGTATTTAGTGGTGGAAACGTACAGAAGTATACGTACACGCTCTTAGTGCGTTATCAAAATCAATTCGTGAGGAAGATACATCTCTCGTT
CCAAGGCTGTTCGAATACTTGTCGCGAAAGGAGCCCTCCCACCGCGCACTCTCGCGCACAGTCACTATCTTCCTTGGTGTAGCTGGTCATTGGTTTGCAA
GACACCCCGAGTACCTCTCAACCTACGCGTTCCAAATCATTTCCAACGGCTTCGAGTCCCAAGATGACCCTGGGTTCCCGTTTAGTCAGCACGGGTTAGA
AGACCATGTAGGCGCAGTGGCACTCCGGAAGTTAACGCTACGCTGTGGCTCGCACTTCTTCAATCCGCTGTGGATGGACTCACTGGTGAACCTGTACCGC
TCGAACCGTGCAGCAATAGGCGGACCAGCAGGCTCATGCTTGACGGGGAACAGTTCGAAGCTGATCGTGGACTCTATTTGCCATGTCCTCACGACTGTAT
CGTATAAGGATGCACTCCCGGTGGTGGAAGAGGTCGGTGCGATCATGTTTGCAGACCTTGCAGCACGGTATAGCCAATTGAACGCGGACGACGAAGGTTC
GGGAGAGTTTCTGTGCGAGATGTTCAATCACCTTATCGTGTTAGCTACGAGGATCCCGATGCAGGTAGACCAAGAGACCCCGCATCCAGTTCTGTGTGTT
CTCCAAAAGCATTGGGGGGTGTTGGAGACAATTTTGCGCTTGTACAATGGCTGTGAAGAAGTGGTTGAGCGATTCTGCGCGCTTTTTGTGGGCGTATTTG
AATCTTTGCGGTCTCAAGCTTTGGAGCTGGCAGCTGCCATCATGCCGGTGTTGCTGGAGCAGTTTGCGCACAGTCATGATGGTAGTTATCTAAGCGTGAT
CAAAAGTGTCATTGGCTGCGCTGGCGACGACGAGGCTACAGCAGTTAGCTTAACCCGCGTGATGGTCATCGTGTCAGAGACCTCGATGGCAAAAATCGCG
GCAGATGGTAGCGTTGATGAGCACCCAGGGCTCACCACTGCGCTCTTTTCTTTGGTGGCAACGTGCGGCACCCACCACCCGTCGATCTTAGTGCAGTCAA
ACCAGTTGGAGGGGGTATTGGCGCTAGCACTGCACGCCTTCAAGTCGCAGAACCCTGAGGTCGGAGCAGCGACGCTTGACTTCCTGCTGGAGCTGGGCTC
TTTGTACGGCCAAATCCTCCGAACCCCGGAGTGCTTGCTCCACGGACCCGAGTTCTCGGGGAAGCTTTTGCTGCACCAACAAATCCAGACGCTGTTCTTC
GAGAAAGACGTGCAGTACCACGTCCTCTTCGCTCTGTTCAATGCCGCGGCGGGGGGAATGTCGCCGAGTTTGATGGAGAAGATCGCAGAGGTCGTTCGGT
CGTGCTGGATTTACTTCGGACGACAGCGCAGCGAAGAGCTAATCTTTAGGCTTCTGTCTGATGGCAGCTTTTTGGGCTCGCAGGTTAGCGAGCGTGCTCG
ATCTGAGTTCATCGCCTTCATTTCCTCTCCGGGTTGCGTGGACAACCCACGCAAGTTTAAACGCGTACTGAACGCGTTTTGCGACCATTTCAAGCGCAAC
CTGAGTGGTGGTGCGAACGCGGAGTCGATGCCTTCGTAAGAAAAAAAATACGCCGCCTCAAAATACGAGGGAAAACATGAAATTGGGCAAGCTGGAAGCG
GCCAGAATTTGTAAGGGAAAACGATGCAAACATTCGCAGCTAAACTGTTCCGTTATAGTGCTCGTTTCTACTGAAACGGGTTACCGACATCCTGCCAGGA
CGTTGTATTGTTCTCTGTAGTGGCGGTGATTAAATGGCCACTCGGAGGTCGACCACCGTAAGCCCCGTTCGACCACTCCAAAATCTTCTCGGCAATATCC
TCTGCCTGCAGATAACACTGTGAGGTCACAGTCATAGCTGCAGTGATGCTCTTAATTCACGTACCTTCGTCCACGTGGAAAAGTCAGCGTCATCCATGAA
CTTGCGGTTCATCGGCGTATCAATCGTCGTAGGAAGCACGCCCAGCACCGTCGCATCCTCAGGCAGCTCAGTCCTGTATAAAAAAACAAAAAAATAATGT
CAAATGCGCCGTAAATCATGGAATCTAATCGCTCAAAACCGTACACAGCACTGGCAATTAGATGATGCGTGGCCGCCTTGCTCGCCCCATACGACACCAT
GCCAGGAGTGGCTTGTAAGGCAGCCGTCGCGCCCGTCAGAACGAGAAGACCTCCAGGCACCAACAAGTGGCTGGCCAAGTATGTCGCTACAGCACGTAGT
CAAGCACGTACAGCGTTAGCGCCTCTAATTAATCCCAGTATCTTCTCCTTCTCTCACCCAGGAAAGCCGATTCAAGATTTTGCGCGTGCATCGTCCCCAA
GTTAACGAGTGAGTCCGCGTCGCGGATGCTTCCTCCCGCCCAACCACCAGCAGTGCACACCACCGTGTTCATCTTTCCGTGTCTGTCCATCATCTGCACG
TAAGTACATATCCACAACAAACACAAGCTCCCTAGTTTGACAGACCTGGAGGAAATCTCTTTCAGCGTCTGCTCCGACTGCTTGAGGGAGTTGCTCTTGG
GTAGCAGCACGTTGTCGTTTGCGTCCTCATTCGCCAAGAAGCCCACGGAAGTGACGCCCCAAGACGCGCGAGCGAAGTGGCTCACCACTCCACGACCCAG
CGCCCCGGCGCCACCAACTACCAGCAGCTTCTTGGACATGATGCAGATTGTTCAATGCGTATCCGGCGGTTTTACAACTGAAGATCAGCAGCGACGCCTA
GGAATAAAAAGGGGTTTTAGCGTCTAAACAATTTCGCGCTTCAATTCACGATTTATCAAGGACAAGCTGCCTTCTGCCGGCAGCGAACATACTAAACGAC
GTATAGCTGTTTAATTAATCTATGCGAATTTCTCCGAGTGGAAGTCGAAGATGGTTCCGTTCGGGTCGGAAGACGAGTACCGCTTGCACGTAGTGTCCAA
GATCTCCTCGAGAGCGTGTGGGCCGCAGTAGAACACCCCAACTTCTTCACCAGGGTGGTTGACCTTGGCCTCGGAAAAGACCTTGTCCCAGTCCGGTCGA
CCGAAGTGCGTGAGCTGCTTCGTGTTCAGACCGGACACAAAGTCCTTACCGGTCTGCTCGTGCACGAACTCCTGGAACATCTTGAGCTGCGACGTGTTCT
CGCTGCCCTTCAACGTACTCAAGTACTGGTGCGTCTCGATGATGTTGTCACGGTCCATTTCCGAGATTTGGTTCATCGTCTCTTCAAACCAACTCAGAGA
TTCCTGTCCACGGGTTACCCAGTGGAAGTAGAGTTTCTGGATCTTGAATGAGCCTGGATGCCGAACGTGGTTGCAGTTTGTGCAGCGGTTGTCTTCCCAA
AGGTGCACCACGTCCTTCAGGATGGAGGCGAACGGAGTGACACCGATTCCTCCACCCACGCAGATGACGGTCTTGTACCGGTGGTAATCTTGAGTAGGAG
CGCCGACCGGACCATCGAGGTACATGTCGGGGTACAGCACCTTGCGTTCATGGCAATCCGAGATGACCCGGGCCAAAGCTTGAGTCCAGTCGCCGCACAC
GCGGATGTGGACACTGATGTAATTGTCTCCAGGAGCTGAGGAAATCGTGAACGGGTGCCACTCGTGGGACGAGATGAGAGGACAATTCACGAACATGTAC
ATGCCAGGGCGGTACACAAAACGACGGGGTTTCTCCATGAACAAGGCTACGGTGCCGTCAAGCTCCATGGCCTCCATGATGCGAACGGGAGCAGCAAACA
TCTTGGCATACCGGAAGCGACGCTCGATCAGATAGAGGAGGAACGGAGGCGTGATCCAGATGTACGATGAGCAACGAGCAAGCCACGAAGCTGCGCCGTG
GAACGACAACACGATCAGGAAGGGTCCGAAGAGCATGTGCGAGTACCAGAAGAGGTTGAACTTGCCCTGGCGGAACTTGGGGATTGCAGCGAGAGGGAAC
GAAATGCAAGTGATCACAAGAAGGATCACACCCGTCCACACTGGAAGCGATTGTAACATCGTCGTGAAGGGAGGACGTTCACCGTTGACGAACGAAGACA
CATGACGCTGGACGAAAATGGAGCGCTTGATCTCTTCAGGAGTGGCAATCAGGTACAGGTAGACCTCGTTGAAGACGTGGGCGATGGTGTGGATGAGGCC
CGCAATGAGCAACACACTTCCAGAGATCTTGTGGAAAGCGATGTGGTCATCGAAGGGGATGTAGCGCCAGAGGAAGCGGCTACGCTTCATCACTTGAGTA
ATCGAGCGGCACATTGGCAGCAGCACGAAAACACAGTTGACCATGGCTACTTGAGCGTTTGCACGGGCAATACGAAGACCCCAACCGATGGCAGGGTCCA
CGTCGTAGGAGAACCACTTGACCCAGAAGGCGACGTTGTTAATGATGACGTATACCAGAAGCCACCAGATGCGGAGCTTGTTGGCGCTGTACCAGGCTCC
GAACTTGCTCTTAGGACGGATAGGTGCCGTATAGACTGGAGCGGACTTCCGGAGGTTGTACGAGTCGTTGATGTAGGGGGCGAACACCGTCGTGAACTGC
TCGAACGTCATCGACTCGTTCTTTACCTGGGCCTTGCGGAACATTAGCTTGGCCACCGTCGAGAAGTCCGTACCAACCACGTCGATGTGGGCGGCCGAGA
AGTTCGACTCCAGTAGCTGGACAATCTGGTCCTCGATCACGTATCCCGAGTTGTCTGGGTCAAGCGTTTCAAAGATGAAGCGCAGCTTCTCCTCGGCGTC
GACTTCGAGGTCCATCACAGCGTCAATTAGAATGGCGTTACCATCGATTTCACCATTGCCAGTGGCGTAGCCGTCAAACTCGTTGCCGTTTACTTCAAAA
GCCTGGGAAAACGTCTCACGCTCAATGTAGCCACCTTTGCTGGTGATGCTGCTCATAACGTCACGAAGTGCGTGCAGCTTCTCCATGGGGGTGTAGGCCG
GGTCGTTGCTGTGAATAGCGTGCTCATCCATACTCATGGCCACGTTGTATTTCTGCTCGAAGTTGCAGTCTCCAAGCACAGGAACCGACACGACGTCGGT
GCCGGGCTGCGGGCCGTACCGGGAACCAGCGAACGACGACAGGTTGGACGCCCGCGCGAGACTCTGGCGCACCATCGAGGCTCCCAGCATTGCCTGGACA
TTCGGACGGCGACGCTGGTTGCCGCGACTGCTCTTACAGTTTGCGCTCATCTTGGCCGGACCGCGTCCGACGATATGTGTGGTGGTGGAGTTCATGTTGA
TGAACTGGCTGCTGTCCATGAAGTTGGACGTGCCTGTGCTCTGGAACGACGTCGTCATGCTAGGGTGGCTCTTCATGGGCGGCGGTGGGGGCGGCGCAGG
CGTGCGCTTGGCCTTCATGCTGCCCTTCCTGCTGTTTGTTCTGCTGGCTGTCCGCTTGCGGCGCGCGTTGGGCGACGGCGTGGAGATGTCAACGAAATGC
TGCGTGTTTTGCCCGGGGGTGATCTTGAGCTCGTCCGCGGGCGTGGCCTGCGGCAATCCGTCACCACTGGTGTCTCCCATCTGGAATCCGCGGTTCTGGC
GGTCGCGGTTCATGGTCCACCGAGAGGGGCCTCGTGTCCTTGCGAAGGCGAAGAAAGCGAAGTGGCGAGTGCAAGGGCGCGCGTGAAGCGGTCACGACGA
TGCGGTCCGTAGAAGTCCAAGCGCGGGTGGCCTCGGAGCGCCTCTAGAAACGCGCTGGCACCTGTGCACAGAGAAAACAGGCAGGTGGCACTGCCGACGG
CGTTGCAATCGCAAATGGCGAAGTGATCGCCGCGGCGCTGGGGGCATTTCATGGCAGCACCTGGTCGGGTGCCGCGCCCGGCTGTGCCCCGTAGATGACA
CGTTAGTAAAGTGCAGCCCACCGAACCGCGATATCTTGGCGTTTGTATCAAATGTTCTTTTTCTCGTCAAGATTCGCACTGACTCTGCAGCGGGTAGGGG
AAAAACGTTTTTGG