Description :
From Genome Similarity Track
Location :
Scaffold_1141:658- 4710
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1141-snap-gene-0.2Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1141-snap-gene-0.3Glutamate receptor-interacting protein 2 (GRIP2 protein).

Sequence
4052 bases(100 bases per row)
GGCTCGCCCTCAACTTCTGTCTCCGCGCCACTGCTGCTGCTCATATCTTCATCAACAGAGTGCGTTGGCGTCTGCCGAAACTGGGTCCGCGGTCGATAGA
CATTCACCGGCGCTTTCTTCCTCTTGCTCTGCTCGCCATCGTCGGCGTCTTTCTGCTGCTGAAAACTCGCCGCGAACGTCGAGATGTCGTCGATGGACCC
ATCGTGGGCGAGCATGTCGTCCGACATGTCGGAATCTGCGCCCTCGTCATCGCTTGCGCTGATGATCGCGTCGCCTGTTGCCTTCGAGACGACGAATTCC
TCTTCTTCGACCTTGCGGTTGGAAGCCGCAGCGCGCCCTGCTATTCCATGCAGCCACGTATACAACCAGACAACTTGCCGTTAGCAGTGTAGATACCATG
AAAAGAGAGAGTGGCAACCCCACTTACCGTATGGATCTTGCGACAACGACATGATAATCTGCGTCTCGTCCTCGTCAATTTCCTCATCTTCATGCTGCTG
CTGGTTGTGAAAGCAAGCCCCGCCGTTGCCATCACCAAAAGACCCTGCCGCGTATACAAACACTGGCGGTCTCTCGTCTCCATCTGCTTGCGTCACAGGC
TCAGTGGCCGCATCCGCCGCCCCTGCGTCGGTCTGCGGCTGCGTCTCTTGGCTGTCGCGCAGCGTGGCTTCGCCATCGTCGGCCACAGCGGTGCCGCGCT
TGCGCTGGATAGCCGAGTACCACTGGCCGGGCATGTCGTGGAAGCCCGCGGGCGTCTGCTCTCCGGACGAGTGCTCGTCGCCTCCCGCGAAGACGCCCAC
GAACTCCACCTTGTCGCCCTGTGTGGGCGCCATCACTTCGCTTTGCTCTGTTTATGACGCACAACGACTCTGTTGCCCCTCTTTAAGATGATCTCACGTG
AATGATATCGTTTTTGAAAGGGTCAAACCTATTAAAGAAGATAACTTGACGAAATTCGAGTGTTCGCAAAGAGTTTTCAGGTTGGTGCGCTATCGTGAGT
TGAACCTACTATATAGAATGCGGATGAAAATGCAAAGTGCGGGCGTCAACTTCACTGCTGAACCTGGCGCAGCGCCGGCGCGAGCGACGTCATGAGCGCG
TAGAACTCCTGGCGCTCGTCGCGCGAGCGCATGCCGAGCTCGAGCGGCTTCTTGCTCTTCGCGAGCGTGATGACGACCTGCGCGCTGCCGCCACCGCTGC
TCTCGCCCTTCTTGCCAAAGTCCAGCGACGCGATCTCGCTGAAGAGAATGGTGGTGACCGCGCCCGACTTGCCGCCTGTTTTCGGCGACGACGGCTTGGC
GGATGTGATCTGCAGTGACGAACTTGAGAGATCGATTGTCATGCGGTTTAGAGAGCGCGACCCTGTCCAGGAGGACTGCGGAGAGAGAGAGTGAGTGGGG
TTCGGTAGGTACGTGTGTGATCAAATGCGCAACTGTTCACCAGATTGATCATGTACTCGGTCTTGGGCGAGCTCAACTGCTGACCCTCATGCTTGTCCTG
TTGTTTTTGCTCGATCTGCCGTGACATCAAGGTGTGCAAGGACAAGACTGTTGTGGTCAAGTCACGAGCGCTTGTCTCGGTGATGGTGAGTTGTATGGAG
GAATGGTACTCACCGTCTTGGATGACACATCTGTTAGTGACATGGACTTCAGCGCTTCGAGCGGCTTGATCGACAGCGACGCAAGCTGCAACGGCAATGG
TGCTGGCGCCGATGGCGACGCTGAGCTTCGAGCGAGCAAGGATACATCCTACGTGAAAAGTGAGAGAGTGTCTTGTCAGTACAGACAAGCCAAAGAAGCA
TGCTGCATCGACACTGACTTACCTTCTGAGCTGTAGACGCGGCTCTCGGAATATCTTTTCGATGCAGAGGCGAAACTGCTCTGGTCGACACATTCTCTGG
GAGCTCAAAGCGCACAGGAGCCTGGTGTCGAGGGCTGCTGGCTGGGCTGCTCTTCCCCGCAAGTCCGGTGCTACCAGCTTGCGATGCAAGTGTGGGCGAG
GGAGACGCCTTGAATCTCGCAAATGTCGTGTCAAACACCAGCGTTTTCGAGATCCCAGCAAAATCCTTGAGGATGCTGACAATTTGCTGCACATCCAGGG
CTCGAAGGTCCACATGATCGATGGCTACGAGTCTGCTTCCGATGGGAATGTTTGTTTCGTTCAGCCCACTCGCGGATTTGCTCGAGCTCGACAAGCTGTA
CGCGGAGATCACAGCCTTGTCGGTCATGCCAGGCTCGAACTCGATTCCCAACGGGGAGTGAGCGACAATGACGCTCCTCAAACCAGGTGTGTGCGATTCA
CTCAGCATACTCGCGTATGCGTCGTGTGTGGTACTAAATGTGATGATCTTCTCGTGAGATGCGAGCATGCGCAACAGCTGAGTGACCTCCGTGAGCTCCA
ACGAGGCGACGCTGACACCATCAATCGCGACAATCTCCGAGCCTGGAACGACGCCGCCGTGGTCAATGATGTAAATCGATCCGACCGACGGGTCGCTGTT
CAAGCGATCGACAATCACTTTGTTGGAGATGCTGCTCTTCAGGTCGATGCCCAATGGGCCTGACGGAACTCGAACGTGTATCACTTTCGTGTTGACACCG
GAGGCTTCGTGTTGGGTGTAGAAGCAAAGCTCTTTCGGGGCGTCGCTGAGCTTCTTCAACAGGTCAGTTACCTGAGCAAGCTTCAGACACGACACGTTCA
TGCTGTTGATACTTCGAAGCGACGACCCAATTGGAACGCGGTAGCACATCTCAATTGGGCCCGGTCGTCCGTCTGGCATCGGGAAGAAGCCAGATACACG
CGCTTGGTCTGGTCTCGCGCCATCGAAATGAACTCCAAGCGGCCCCTTCGGCACACTGACAACCTCAACTGAGCGTCGTTTCTTCAGCGCACTCACGAGC
GATTCGTTGGCGACGATGATGTCCTTGGGTGAGAGCTTGAGCTTCAGAAGGAGACCGGAAACCTCGGCAAGTGTGTGGCTTACAACGCACAACTTGTTGA
TCGAGATGATGCGGCTGCCAGGAAGAAATGACGTGCAGCTTTTGAAGACTGGTCGAGCCGCATCTGCAGCACTGGTGAAACCAGAGATGGCAGCGTTGTC
CGTATGAGATCCATCCAAGTTGAGTCCAAACGGTCCGGACTCGATGCAAATCTTGTGGCACTCTGGAAGGTCGACTCTTCTGGATCGATAGAAGTACAGC
GTTCGTGGATATGGTGCAGAGGTGAGAATTGCGAGTGCGTCTCGGCGGTTCAAGCAGGACACGTCCGTGCCATTGACACCGACGAGCACGTCTCCCTGGA
CGAGGGTCGCTTTCATCGCCGGAGTAGTCGTTGTCGCGACCACGCACTTGAAGTTCTCCGACTCTTCGAATGAAAACCCTTGGGGGATATCAGCGGACGC
GTACTCAGCTTGCAGGAATTTGTCGCAGCTATCGGGCGCCGTGCGGTAGACGATGATTTCCTTCTCTTGGTCTCGCAGATTCGCGAGGATCTCGATGACT
TTTTCGCGAGACGAACGCGACACGTCGACGCCATTCACGTCGACGATTTGACAGCCGCGGTGGACTTTCGGGTCCCTCGCGAGTTTGCTTGTCGATCCGT
CTGGAAGCTGCTGAAACCCGTCAATGACAGCTCCGTAGTGCACCAGTTCGCTGATGAGCAACCCAAGCGGGCCTTTTGGAGCGTGGACGAGCACGAGCTT
CTCGACATCGTACTTCTTCCTGTCGTAGTGCGACGTGTGGTACCGCGCAAACGTCAAGCGTCTGCTCTTCGCCGCAAGCTTCCCCAGGCGCACGCTGACC
TCTCGTGGGCTGCAGTGGACGACATCGTCGTCTTCGATAGCGACAAGCCGGTCACCAACACTCACGGTTTGCCGAAGCAGTTGCATGCGCTTTCGATCCA
CGTCGTCCCAGGCCGCGAGGTCTTCTTGCGTCAGCGTATCGATCCCGCGGACGACAACGAACCCTTGATCAGTCTCCCCAAGTGTCATGCAGAGACGTCC
TGGTGCCGCTTCCACGACGAAGCGCTCGCGTCCAAACTCATCGAGGCCGATT