Description :
From Genome Similarity Track
Location :
Scaffold_265:658- 2523
Transcript NameFunction/comments
g7794.t1hypothetical protein

Sequence
1865 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGGCATTCCT
GCGGAGTTACCGCAGGACAAGGGTTGTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAG
TCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAAAGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTCAAGAAGCC
ACCGGGCGGGTGGCGCATCGTTCATGCTTACAACAAGCTGAACGACGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCG
ATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTC
CGAGCGGCATGCTCTGGGGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGC
GACTTCGCACCTAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGC
TTGAGCTCATGCAAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTATCTCGTGGGGAAGAACGG
CGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGACCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTG
TGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCTGCTCTTAAAGAAAGAGGTTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCT
TCGAAGCAGTCAAGCCGGGCTTGACTGAGGCGCCGATCTTGGCGGATCGCCCATTCCACGTTGTGTGTGACGCATCCGATTTCGCGATCGGATGCGCACT
GATGCAACACGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTAAGCGTAACTACCCGGTACATGACAAGGAACAC
CTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTGCGAGGAAGTAGACGATTCGTCGTCTACACCGACCACGCATCGTTGCGTACGGCGATCA
AGGCGCCGCACATATCACAAAGAATGGCACGGTGGTTATCATTCTTTGCGGAATACAACTTCCAGGTTGAGTACAAGCCTGGAAGGTTGAATGTCGTGGC
CGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGTTGGAT
GACGTGAAGGCCGCATACGCGCATGATGCGGATGCGAAGCAGTTGTTGAAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACC
TTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCAGATGATCATGA
GCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAAAAGACATACGTGCTTCTCACGCGTGACTTCTACTGG
AGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGTCAGCGCATGAAGCC