Description :
From Genome Similarity Track
Location :
Scaffold_2684:658- 2075
Sequence
1417 bases(100 bases per row)
AGTGGCGGCAGGCGTTAGATACAGAGTATCAGTCCTTACTAGAGAATGGGACGTGGAAGCTCTCACAGCTACCACCTGGTCATAAAGCACTCCCATGCCA
CTGGGTACTTGCGGTGAAGTACAACGCAGATGGTACCACAGAGCGGTTCAAAGCGCGACTAGTCGCCCAAGGGAACCACCAAGAGTATGGAGTAAACAGT
GACGAAGTATATGCACCTGTTGCTCGGTTTGAGTCACTTTGCCTGGTGCTAGCAATTGGAACCATTTTGGATTGCCACATTCATCAGATGGATGTTCACA
CAGCCTTTTTAAATGGGTCTATGGACGGTGAACAGAAGGTGTACATGCACCAACCTCCTGGGTACAAATTAGCGGGCCATGAAGGACTAGTGTgtgagct
caagaagagcatATATGGACTTAAGCAAGCTCCAAAGATCTGGTACAAGGTCCTCCACAGATTCTTCACAGAGTTGGGTTTTGTCCGATGCAATAAAGAA
TACTGCATCTACGTCCAAAAAGTGGGAGAGGATTGGATAATTGTAGTCGTCTATGTGGATGACCTGGCAATCATGTCTCGTGACATGAGGCTGATCAACC
AGCTGAAAACAGATCTCTCTGCGAGATTCAAGATGAAAGACCTGGGCGACATCCACTACATACTAAAGGTGGAGGTCCGTCGGAATCGTGAACAAAAGAT
CATGACAATATCGCAACACAATTACATTAACGAACTGTTGAAAAAGTTCAACATGGAAAATAGTGTGCCAGTATCGACCCCACAACTCAAAAGCGTGGAA
CTCGAAGCTGAAACAGAATTGTCAGCTGAGCAAATAGCAGCCCAAAAGTTTGACTTTAGAGGGCTTGTCGGATCACTACAGTATCTGGTCAGAGGAACAA
GGCCAGACATTGCCAATGCAGTAAGAGAACTGAGTAAGTTTTTGTCGTGCTACAACGAAACGCACTCCANTACAACGAAACGCACTGGCAGGCAGCCAGG
AGAGTCCTAAAATACTTGAAAGGGACGTCAACGTACGGTCTACTTCTTGATGGAAAATCGAGAACGGTGACGTATGAAGTGTACACAGACGCAAGCTTCG
CGTGTCAACCCAAAGAACGTAAATCAGTTACAGGGTATGTCATCTCCATGGCTGGCAGCAGTATATCGTGGTGTAGCAGCAAACAAGGATCAGTATCACT
TTCTACTGCTGAAACAGAGCTCATTGCACTGAGTGAAGGAGCAAAGGAAAGCGAATGGCTATGATACTTATTAAGAGAAATGGGATTTCCCCAAGATAAA
CCAGTACAGGTATGGTGTGACAGTAAGGCAGCTATCAGCACGGTAAATAATCGTGGGAGCCACAAAGCTACGAAACATATTGAAATAAGATACCTATTTA
CACGAGACCTCGTGGAG