Description :
From Genome Similarity Track
Location :
Scaffold_1640:658- 2055
Transcript NameFunction/comments
Phypl_g13875multidrug resistance protein ABC superfamily
Phypl_g13876hypothetical protein PHYSODRAFT_289152

Sequence
1397 bases(100 bases per row)
actcctccTGCTTTTCTGCTCTTNTTCTTCGGCACTCCTTCCCCCGTGAATTTCATCGGCTTCTCCGGCTTCGACATCGCCGCTGGATCCGAGGAAACTT
CCGCCAATTGAGCTCAAAACCCTAGAACGCGCACCCGTTCCAAGCCACGGAGAAAAAAATGAAGACTAGATTTAGCGTTAGCTGCTCACCAGAGCTCCTA
CCAACACTCAACGGGTTCAAGCCCGTTCCCATACAACGACCTGNCAGCTTCTCAGCTCTCTTCTCAACCTCCGTGTGCCAGGTCTCAGATATGAATTCCA
ACACGTCCAAATGACCGTGGATCTTGTAGTAGCAGCGCAGAGCTGGCATGATGACTTCGTTCCATTGGTAGCCTTGGACGTCTGCCACAAACTCGAGCCT
TCACAGCACGGGTCAAATAATGACCCACAGACCAAAAGTGTACCAAATACAAAGCACAATTGCACAAAGCTTCCATAGGTTCAACTACCAAATCGTAAAT
CACAATAATATCCCTGGGCAAATCACAAATACAAAACTGTGCGTATTCCAATCAAACAAATACAAATCACAATAGCAAAACACACATTTGTGCTGCTGAC
CTAATTCACTAAATTTGCAGTTCGAAGACCTTGTGTTGGCGACCCAGAAAAGGTAGATATTTGAAAGCCTCCAACACAACTTGAGCAACTTTAAAGCTGC
CTTTCGCCATATGGTTCTGTCATCGAGCAAGATACATGAACAGCGTAGACCCTGCTACAGTCTGCACAATCTTCAGGCATGGCTCGTTTGGGTGTAGCCG
GGAGAGGTcgctccgccagcttgaTCGTGTACTCTCCTGTGACGTAGTTTCCACCGTAGAATGCCGCTCCCACCAGCGTGTTGAAGTAGCCGATGAGCAC
AGTCGAGTTGGCATGTCCGCTTCCCGCGAAAGTGGCGATCTGGGCATTAACAACAACTGGAACAAGGTTCAAGAGAATCAGTGGGTTATTCAACGGCTTT
TTCAAATCAATTCCTGCTTGAAATCTAAACGGAGTAGCCGGCGCACATGGTGTAGGCGATATAGTCCCATTCGACAATGGTCTGGTCGTAGTCAGccgtt
gtcgccgccgctggcgtACAGGAACTTGGCCACATGCACCGTGGCGCGGTCGCTGAAGGTCGTGTTGTCCAGTATGATGAGCACGTTCCACTGGATCAAC
TATGCTGTTTCGCCGGTCGTCTTGACCAAGAGCTGACCTTACTCGAGCTGGAACTCTAGCGGCTGCTTGGGCGTGACGATGTTGATGGTCtcgttgctgg
agatgcaTGGGGTTAAACGGGGTGGTGTACGAAAATCACGTCGCCTTGCTCAGCTGTGCCGTCTCGCCGGTTGTTTCAGCCGAGAGCTGAccttcct