Description :
From Genome Similarity Track
Location :
contig_27:657884- 662971
Transcript NameFunction/comments
g6016.t1hypothetical protein

Sequence
5087 bases(100 bases per row)
AGCCAATAGCAGCAGTTTTACGGAGATGGACCTGTGTCCGGCCACGGAAGGAGCAGCTATGAACGCGTGGCTTGAGCTGCAGTCGGTTCCGTCCCCGGGG
ACGCTCTCCACGACGGCCATTGTGCTGCTGGCAGTGTCTATGTTGATTTGTGTGGTGTTGGCCATCTCGGTGTGGTGGCTGAGCCGATCGCGGGCGTGGC
TGCAGGACGCGTACGACCGCGTCATCTTGGAGGGATCGTGGGACGACGGTAGCTGGTCGCCGACGTCACATTTACTAGGGGGCCCACTCGCTCCGTCTCT
AGCGGTCGCAGGAGCTACAGATGAGGAACGACTCACGCCCATGGAGGTTTTCTTCGGAGCACGACCGAGAAGTCGACGGTCACCAGGGATTCACGGCACT
TCAGCACTCGTAGCCACGACACGGGCCGAGATCACGCTGTCCAACGACCAGCTGTGCCGCAAGAGCGCTATCTTGCGCGCCTTCGTGTCGGATCCGGCCA
TCGTGACTAAACGCATTTCGTTTGCGCAGCTCCACTTTTTGAGGCTGCTCGCCAAAGGAGGCAGCGGGGAGGTGTGGCTGGGCCAATATGAGACTCGCTA
CGTGGCTATGAAGTGTTTATTGCCAACGAAGCGAGAAGACCCAGAGGCCTTGGAGCAGTTCGCAGAGGAGATCAGGATGGCGTCGTTTTTAGCGCACCCG
CGCATCGTGGCCTTCTGCGGCGTAGCCTGGCAGTCGCTCTTGCACCTTTGTGCAGTGACGGAGTACATGCCACGCGGTGACCTAGAAAACCTGCTGGCAA
ATCCAATTGCTCAGAAGGAGCTGAGCTGGAACAGAGAGAAGCTCACGCTGAGCAGTGATATCGTCGAGGCGTTGGTGTACTTACACTCGCTGGTGCCCAT
CGTGATTCATCGCGATCTCAAGTCCAAGAACGTGCTGCTGGATCGGCGATTACGTGCAAAGCTGAGCGACTTCGGACTGAGCCGCGAACGATCCGTGGAG
GACACCATGACCAACGGCATTGGCACGATCTTGTGGAGTGCGCCAGAGGTATTAGAGGGCAAACGCTACGACGAGAAGAGTGATCTGTTTTCGTTTGGTG
TAGTGCTGTCTGAGATCGACACGTGCGCGCTCCCGTACGGCTTCAGCCGCCACGCCAAGATGCGCAGTATGCAGGTCGTCCACCTCGTATCCGAAGGCAA
ACTGCTTCCCAACTTCCGGGACGACTGCCCGCCAGCAATACGAGCGCTCGCACAGCGATGCCTAAGCTTGGACCCTGCAGCGCGTCCGACAGCAATGGAA
GTCGCCTTCGAACTGCGCTCTTCCATTGCTCCCCAGCTACTGCAGCAGCCGATGACGGCACTGTTAGTAGCGGACGATGACGGCGCTGTTAACGTTAGTA
GCGCGTCAACTCCCCTCACCCAGACGTCTCCAGCCTTCACAGCAGTCGAGAACAGCTCGACGCCACCTGTATCATCATCAACCGAGACCGCAAACACGAA
GGAGACCCAAACGGATCCGTGATCTTCAAGACGAAAGTAGTCGCCAACGGTTAGGAACGCGAGCCTTGGCAAGTCGCGTACAGACCAACGGAAGCCCATT
AATTTATGAGAACAAAGCTTGTAAAAACCTGAGACCGTCGCCACCCAGCAATAGCCGACTGAACATGCTGACACTAGCGAAACGGACGTGATCACTGTCT
CGGTGAGCCTCTGGATGTGGAGGTGGGAGACGTGGGTTTCCACACATCGATAGCGCCATGGACAATGACCATGAGCCATCGACCTCTAGGGCGCGCAAAG
CCCTACTACTCCGTCGAGTACCGATCCTGGCACATGTCGTGAAGCAGGGACTGTGCTCGGAAGGCGAGTTGCTGCGTGCATTGGAGTACGTGACGTACAG
TGACGGAGAGTACATTTATTGCCAAGGCCAGCCGGAACGAGACTTACTATTCATCGAGGAAGGCAAAGTTTTGATCACTCAGCGTCGGCGATCTCGTGCT
ATGAGCACTACAGGTAGTCGCCCGGTGGGGTTTATTCCGATGGACAGCTCGGGCGGTGTTGTATCCTCTCGGCGGCCCTCACGACGGCGCTCGCAGATTG
AAACTGAGATGGAGATCCAGCTACACAAGCACGAGGAGCTCGAATACTTTGGCGAGGAGTCTTTGCTGCAAGGATTGGTTTCTAGAATACTCAATGCGGT
GGCTAGTGGAGCGGTGACGTGTGCCGTACTCCCAGAGGCTTCATTTGCCAGGTTGCTGGCACCGGTACACGAGTTAATGCTGCATCGGCATTTGTTGCGA
ATGCACGGCGTGCTGGCAAAACAGCGAGTATTCCAGCACTTCTCCGCTCGTCAACGACAGCACATTTTGGATCGTTGTACTCTAGAACACTACGAGGAAG
GAGCTCGAATCATTCAGCAAGGTGATAAGATGACGACCGATATTTTATCTTGGCCGAAGGGGAAGCTGATGTTGTGCTAGATGAGCCCTTGCGAGATCTT
CGGCCAAATAATTATGCAGAGGGGATTGAAGGGTTTGAATATGGCGGAGAAGAAGAGGACGGTGGGGGCAGTAGAACATCGATTGTGTGTCGAAAGGCGC
TTTATCAAGGATTTGGCGAGATGGGGATCTTAGGCCGGCCTCGAACAGCGCATGTGGTTGCTGCTGGGAGCGTGGTTTGTGCAGCGATTTCGCGAAAGAC
GTACGTTGGCGCTTCGCAGTTGATAGGCGTTAGTGGCGTTGATACGGACGCGGAGGCACTGCTTGCTATGTCTCTGATGGAGGAGTGGGCCCTTGTGGTG
AAAACTCGGAGCCTCCATTTGGCGAACCCGTTGGTGTCTCGACATCTTGAAACCTTTGTGAAAAAGTTTAAGGCCGCCTACATGCAGAAGTTTGAAGGCA
AAACGCTGTATCTAGACCTGCTCCGACGAATGCACGCAGAGCCTTCACTTGCCGATGAATTCCCGTTCGTGTCGGACCGAGTGGCTTGGGATGCACCAAC
ATCATCGCTCAGTATCACGCGAGCTGAGACTCGACGCGTGCTACTGCTGCCTCCGGCTGACCGCTCCCCGTTCGAGATCAGCTTCATGGCGCGCTTGCTC
GAGCCTACAGCGTTCATTGGGAAGTTTGACCGGCCAGCTCATGTCGATCAGCTCACGCTCGCTCGCGGGATCGCTCGATTTGCCTCGTTTGCCACCATCC
AAAAGGACAAACACCTCTTTCGTCAAGGCAAGATCGAAAGCCGCGCCTTCCTCATCTTGCGAGGCAACATCAGCATCGTGAACGAGGACGTCAGCACCAT
TCAGACCGGTCTCGCCGTCAAACACTACGACGTACTCGCCACACTCTCCGCCGGAGACTCATTCGGCGAGCTCTCACTTGTAACGCGACTCCAGCGTTCA
GCCACAGCTCTGGCTGCCTGTGAGGCAGATTTGCTGGTACTAGAGCGTCCGCATTTGCAGGCCTTGATGGCTCTGCTACCAGGCGTATCGGTGCAGCACG
CCATGGTGGAGCGCGCCGAATTCCTTGCAACGCTCAACTTTCTCCGGGACAATGACTTCGCGCAGTGCATTCGCGTGGCGCATGACCTCCAAGAGCAGTT
CTACGAGCCACGCCACCTTTTCCTCCAAGAACCCGTGCACTTGCGTACGCTTTACATCGTCAAGAGCGGCGAAGTAGTTGTGTTTCTGCGTCGGCACGTG
CCAGTTGCTGAGACTACAGGGACCTCAGGAGCGAATGACGTCGCACCGACCAAAGAAGTGCTTGTCCGAGTGGCAACGATTGGACCGCAGGAGTTTTTCG
GTGTCGCCATTGCCAGCGCCAACATGCTGTCAGCGAGTGCATCGGTAGCTGGACCGATTGCCTCGACTGGAGCGTCTGCTTCACCTACCAGTCCCAGTTC
TGGGGCCGCTTCTCCGTCACCGCCACCTCTGACGTCTCCAGCATCTCCTGCTTCTCCCTCGTCGCCAGCGAAAGCTCAGCTGTATATTGCCGCTACTTTA
GCGTCCGTGACGACAACGAGTGGGGCTTCGTCCACCACGGCCAACTTTGACCTGGCCAGAACTGTGTTCATGTGCTCAACACAGGTGCAAATGCTGGAGC
TCTCGGAGCGAGGCTGGAGACGTCTTCCACTGTCCAGTCTGCACTGCATTCGGGAGTCTCTGCTGGAGCGGCATCGCTGGAACCTGGAGACAGCAGAAAA
GCAAAACCAACAGTCCTTCTTTCTCGCAGACAAACCCTGGCAAACAGCAGCACGGCCGACCACTTCCAGGTCGTCAAGTACGCCTACTACCGACAGCAAA
GACCCCCAAGCCCGAGCACTAGAACCCGTACCAGTAACGCAGTTGGCTCGACGTATCAAGGACAAGAAGCAGCAGCAGCATCAAAAAGGCCACCAGAACG
CCGTCTCCCGACTCTTCTCTCCTGTTTCAGTGGCACTTTCTCCGATCAAACCGAATCATCTCTCGGTTCCCAACATTTGCGTTGAGCGCCCTGCATCGAC
ACTTTCAAGTCGCGGGTCGCCACTCTACGTGTCAGTCAAGCGCGACCAGCAACCACAGGATTCACGTCCTCATCTCAAGACAGGAACTGGGTCCCCAGCT
TCTGCTTTGCCATCGCCGCGCTCGACTCAACTGGGCGGGTCCTTCCAACCGAAAGGTGTCATGATAACGCACTCGTCCTTGGCAGTTCTTGACCAAACAC
CTACCAGCCCCTCGACACTCAGTGCGCTGTCTCCTCGTCCGCCCTCATTGGTCTCGCCTTCGGCCAGTCCACGACGAGACACTGCACAGCGACGACTGAG
CTCAAACCCCAAGCAAAACACAGCAAACTCCCCACAAACGACAGCAAACGACTGCCAGGCCATGTGGAAGCTGCAGCGCAGACCTTCCAAACAGTAGAAA
GCCATGTTGCAGTTGCAGTTCTCACACGTCACAGATGTAGCCATCTACACGTTGAAGTTCGTCGAAGTCAACTTTTAGCCAATCATCACCTATTGCCTTC
CATTCCTCAATTTGCGAAAAACCGAACATGGCGACTCTCTCGCTGGGCGCTTGCGTGGCCGTGACGGAGGCGCTGCCCGCCCCCGCC