Description :
From Genome Similarity Track
Location :
Scaffold_1310:6576- 11218
Transcript NameFunction/comments
Phypl_g13076hypothetical protein
Phypl_g13077hypothetical protein

Sequence
4642 bases(100 bases per row)
GGAGCGAAGAACGGCACGAGAGGTCCTGGTGGAGCGCGCCGAGGAGACGAAGAACgcaacgacgagctcgacgaagacCCGGACGACGAAGGGctggagg
gcgacgaggagtcATGGCCATCAGAGTCCccggagccgccgcccaACGCACCGTGGCTTGCCGAACCCGCGGAGAaagatgacgaagagcgcgaagCATG
CCGACGAGTGCGTCGACGCTTAGCCCGACTGGAACGACGGCTGGAGTCGCGGCTCGAAGACTCGTCCTGAGATCCTGCGGACGGCGatcgccgccgacga
gaagTCGGACCTGGAATCGGCACAGACTGATGGGTGGTAGCCGCAGGCGGTAAGGGCACATTCTCCACTAAAGGACACTGCCCGACGTTGCCAGGCAAAA
TTTGAGACCCgtcgccagcttgagcaggatCGTGGGCAGGGAGAGGGATCGCAGCGGTAACGATAGGGAGGGCTGGCTCGTcccagccgccgccactgcc
gctACAGTAGGACGCCCGGTCAAACTTCCGTCCAGATCAAAGAAATCTTCTGGATCGTCAGATAGACCGTTCCGCTCCCGGTCGGAACTGAACCTCGAAC
TGACAGACTCCATCGGTTCGTCTTGGTCTTCAAGCGGTAACCCAGAAGATTAGAATTTTGTCATCGCGATTTGACGCGCTGCGTAGATCCTCATCATCTT
GGCGAACGCATCTTCGATTCCAAGCGGCGCTGGACTGGCGGACCACGCTCCGGTACCGATCGCATTATCCGGCTTCTGGCGCCCCGACGTCGACTTCATG
CGAACGGGAGTGCCGTCGCTATCATCATCGGACTCTTCGACGACCGAAGAGACCGAATGGTATCGGGAGGAACCAGTTGATCCTCCGCGCGACGAATCTT
CTCGGGGTCGAGAGGTCCGTTCCACGTCGGCTTTAACCGTTCCGACCAGTGTCGACAGCAAATCGAGTAGCTCCACGAACATATGTTTCCATGCCTTGAC
GTTCCAGTCGTACACGCGCACCATCCCAAACACGTCTAGGGCGTATCCAGCATCCTTCAGCACACTGAAGGTTGCATGCACGGCACGCCGGACGCTGGTG
AGAGTGATAACGTTTGGGTCCAGAACCGGACCGGTCAGCTCGCCTACCAGGGTGGGTCTGAGGATCTTCAGGATTGGGTCCTTCCTAATCATCCGGGCTA
ACTGTGAGCGACACAAACTTTGTTCTAGGTCTTCAAGTATCGACTGTTGACCAGATTGCATGTGAACAAGGTTGGGGACCCTTCATCTTCCGACTCCGGA
GCTCTCACCTTGCCCTTCGACTTGCTCGGCTTGCGCCGagacttcttcgacttcctccGTACAGGCGGGTCTTCGTCGGGGCTTTGTCCATCTTTAGCAT
TCGCAGGCTTCTGACGGGCAGGGTCTTGACCGGAGTCATAACCCGGGGTGGCTCCGCGGGGAGCCACATCGGGGACAGCGAACGCTGCTTCGTacgcttc
ttcatcatcgctgGCCTCTCGGCCTACTGTGGACGTCCCCTCAGAGTCTATCAGCACGGTGGGTCTCATTTTTCCGAACTCAGCTGTCATCGATGATCCA
TCAATCGATGACCTTCTGGCCTCAGGTTCCTGCTTGATGCGCATACCGTCTTCTGGACTAGTAGTCCCGGGTCGCGGCACCATTGTGGTGGAGCGGGTTC
CTCAAAAACCGCTCCGCGGTCTTCTCAATGTTGTCTCCGACGCACAAACGCAACGTCACTGTTATCGTGAGTAGACGTCGCGTGATTCCCAGGCCTTAGC
TAACGTAATTCCAGGGACGGTGGGCGCAGTTATTCTTGCAGGCGACGATCACGTCACCGAGGCCTTGTTGTTGGTTGTTGGCAGGCGTGGGGATGGGCTT
CTCACGCCACCGGTTGTCTtccttcgtctccttcctccgGTCTCCGCAGGACCCTATCGTTTGTCTNAGTTGTCTtccttcgtctccttcctccgGTCTC
CGCAGGACCCTATCGTTTGTCTTTGCGGTCTCCGTTAAAGATTCCTCCGATCCGATCCGTTCACGTCCGTTCCGGGCGTATGGTCCGTTCCAGATGGAGT
CCTCTGTCTTCGTCGCACTTCGGCCCTATCGCTTGCCCTCGTGCGTCTTCTCTCCGTCGGTAACTCGGCCCTTTAGCTTGCTCCGTTCCGACGTGGCTGA
TTTAAAGTACCTCCCTGTCAGACACTGGTCGGGGTTGAGTACACGCAGCCAATCGGTCGTAGCGCCCCGCGTCTCGTAGTCTGGTACGGCCGAGGTCGAA
TCTTCTACTTGGGGAGGTTTTCGGCTCAAAAGCGGCGAAGTCGTGGCAACAAAGGTGTATTACTTGTGCTGGTACTTGCGGGCTTGAGCTCAGATTGCCG
ACTGACTATCCTATTCTCCTACCTTCTCGCCTGGCCGAACCACTCCTCTACCTCTGCCTATCTTGTCGGGGTATATGCGTTTCCTTGGTGATCTCCGCCA
TCCATCTTCGCTGACTGAGCGCGCATATGCTGCCTTGCACATCTGGGGATTCTGTAGACTGAGTCTAAGTATAGACTTGATCGAGTCAGCGCGCTCACAG
CCGGAAAACGGAGTTTCGAGTTAAAACCGGTTTGGACCAGTTGACACCGGTGTGGAGTAACGCCCTCGCGTGAATCCGCCAAGTCGTCCTCGCACAAACC
CGTCGCGTCCTTTATGCAGACTGCGTCGGGTATTTTCCCGGTTCTTGAGTAGCGTACCTCTGGGTGAAGTGAAGCTCTAGCGGTGTTGTCGCTTGAACCT
CGAAGAGTTGCTTCGACGCAGCGCGGATGGTCCTCACCCTGCGTCTCNCGGCGTTATCGGGCCAGCGcgggtcttcgtcgtcggggTCGCGTTATCGGGC
GGCTCCTGGATGGTATCGTTTAACGTGTCCCTCCTATTGGGCACGGGGTTGTGGGGTTGAGTCCCCGATCCAACTAGCGCCGGGGGGCCGCGTTATCGTG
GCAGCTCTGCTTGCCGACGCTGGaaggttcttgagcacgaagGGATTCCCACTTGCGTATCTCAAAGAATATTCGGGACTGCTCGCCTTACCCTATCTTG
TCCTTCCCTATCAGCCGCCTAGTTGAAGCTCTGGTAGCCTCTCGTTGTGCACCCATCGACTTACTTGAAGCTCTTAGCAGCCCCCATTGTGTACCCATCG
ACTTGTCGTGCTCGCACGTCCCATGTTGACGTAAACCTTAGATCGGGCCTTAGATCGGGGCCTGGATCGGGGTCTGGATCGAGATCTTGGATCACGATCT
CGGTCCCTAGATCGGGCACATAGACGGGTCACCCCGATCCGACGTATGGACGAATCTCCGGACGGGCGCTCTAAAAAAGAGCCAGATCTCAGATCgccga
ccatcactctttGGAAGGTTCCCCGCGGATCTCGCGTCGCTCGTTTCCCATCGATCTTGGTCACCCCGGCTGTCCCGCGTACTCCGCGCCATTCTGACTT
CTCGTCGGAGGTCGCTCTACCACAGCACCGAGTGTTTCCTCGCTTTGGGGCACGAAGATCCAGGTTGCTGGCGAAAACCGCGTCGCCGACCTACGCGGCG
GCAatctcgtcgcgcagcgATAGCTTTGGTGGCAAAATCGTCAGGTTCAAACCTGATGCCATGCAGTGGGCACAATCATCCTCATCATGATGACGGCGGC
AGGGTGAAGGTGGGGCCGACCATCATGTTTTCCCACTTGAATACGATGGACAGCGTGTTCATGGCGAGCATGGCGATGGTCACCATAGTCCATGCAGCCG
CTGTACCCGACCTGTGCTCCGTCCTGGTAGAACGGATCGTTGCTCTCTCCATCTGCGGTCGGCTCAAAAACAAACCACCCTGACAACTCCGTCCACTGCA
CGGGTTTGCCATCTCGGCTGACGGAGCTGAGCGCCGGGTCAGTGAGGCGCTCGGGCGCCACCGACTGTGTGGTGGAAGAAGTTTCTTTTGAACGGCGAGA
ACGGAAAGTGCGTACGCGGGGATAAGATCCGCGTGTCACTGACTGGATCAGGAGTCACTGGTTGAAATCATGTACCCGTTACCCCAGATCACAGCCAGTT
CGCTATACAAAGAGCAGACGTtggagaagaacaaggagACGAACCCGCCAGAGGATACAGAACGGCGTGAACTTACCCGGGCGTGCGTGATGGTCGAAAG
GAATGGCACGAGTCCAGATCTGCATCAAGTGAGGCAGATCAAGGCACGTTTACTCCGGATCCGATCTTCGGATCTGGAATCTGGAGTCCTTGATCGGGGT
GATCAGATCTGAGGTCAAGGCTGTGGATCTAACGCAAGGAGCACGCTGACAAAAAAGATCAAGGGTGTTAACGTCCCGCTGATAGTGTGGAAGTGTAACG
GGCTAAGTGGTTACCCGTTACTAGCTTACACGTAGCGGTGAGGAAGTGCgtagcgacgaagacaaagTATTGAGTCCGGGGAAAATCAACTCTGTTTTAG
TATTAGGGTCAGGGCGGGTGCCCCGGCCTCATGTGAaccactcaaatgcaggtcAGCACGTAATTGGATGTTAAGGGGTCTGACTCACCCAATATCAACC
AATCAGCGCGTGACACTTCAGCACCCGCTAGCCGGGTGTAGC