Description :
From Genome Similarity Track
Location :
Scaffold_25:65732- 68063
Sequence
2331 bases(100 bases per row)
GTTTGCTGCGTCGACTCTGTCGTCGAAAACAATTTTGCACACTTTGCATCCTACTCGGCGATGTAAGCTCGAAGCAGCACTTCCTCAAAAAGGCTTGGAG
CCACGCACCAAACATTTCTGCGTTTTCTGGGCTTCAAGGCGATTTTGTCGCTCTCGCGCTGTCACGCGCACGCAGATTTTGTCGTGGAATCGTTTTAACT
CGTTCGACTTGACACGCAATCGGTCTTTGCTCTCCTGCCGCATGGACTCTGCTTCGGCCTGCCCACAGTGTGTGGTGTTATTTTCTCTATTCAAACGCCA
TACCTCTGAAGGGAAAAGCGTGTGATCACCTCGACATCAACAACACTAAGGTCAAGCCAGTCGGATTCCTCTTCATCATCTACAAATCTATAATCTCCAT
ATTTACCCCTGTAGAAAACAGAAACATGTTAGCTTTTTGTTGTCGCCTACAATAATTCTTGAAATGGTTTACTTGTCGACATGGAGAGTGGGCATGGGAG
GTGAAGGATAAGCTTGAAAGCGTGCCATGGACCGACATGGTGAGCAATTCTGTTAGAATGCAACGAGAAGTAAACATACGTCTCTCTCTTCTGTGTCTGA
CGCATTCATTGCGACTACAATCTTGAAAAGACGCACACAAAATCTGCAAAAGGTCGCGACGTTCATTCGTGGGTAGACCAGCATGCCAATGACACAGTAC
TATCATGTGCGCGATCCTATGGAGAACCTACGCATTAGCGTGACAATACGCAAGGTCGGTAAGCGAAAGTAGCGCTGAAAGGGAGACGCTCACAGGCTAA
CTGGCGAAGTGACAGATCTCCGGGTTCGGGAGTGATTCAAGTGGAGACTCGGTTCCCGTGGGCAGGACATGGAAATATTGCTTCCGGTGGCAGGAAAAAA
AGCTTAGCATGAGGTGCGTGGATGGTTGTACTGTCAGCAACAATAGCAATGCAACTGAGAGCAGTTCCTATTGCATTGTACAAGTGAAACGAAGCGAGAG
CAGGAGAGTCTGGAGGCAAGGGGGATTCAGTTGTCGAATCGAAAGGTGTGTACAATGTTGCAAAGAATAAACGATGCAACATACAGATAGATTTTCTTTG
AAAAAAATGCAGCGCGGAGATAGAAACTTACCCAAGATTGCCAACGCCGATATTTTATCGACATATGTCGATGTCGACGACTACGTTCCAAAAGAGGTGG
GCGCTATAACTTTATGTTTTTACTTGCTGCGGACTCAACAATGGGATGTACCATTCAAAGGAGCGACCAAGCACATCGATGAACACAACAACGCACCTCA
TTCCACCAGATCTCACTCGACGACCGCGAGACAGACGAAATGAATCTTCATGGACATCAAACCAGCATCGTGCGTGGCTCCGAGCAAACCGTGAAGATAA
ATTTCGCGCGATGCACATTGTTGCTCTTATCGAGGAGGTGGAACGCGTGCTTTGTTCGTTCCGGTTTTACAAGGAAAGCGGATTGTTTTGTGCGACACCA
GGATTTTCAGCGCCAATCGTCGACCCTGAAAGCGATCCAGACTTGTTCGTAAAGGGCCCCAAGCTCACCACGTTTCACGTGTCAACTCCGTCGGGCTCCC
TCTATGAATACGTGCTAGACAACACAAATGACCTACTACCATTTGCCTCCGCTGAGGACCAACGTCTTGCACGAGAAATCCGCTTGCAAGAAGAAAAACG
TGATACAACTGAGGTTTCTCGCTGGCAACAACTGGATAACCCCCCCAAACTTGTCGAAGCAAGACCTGGTGGCTCTGGAAATACGAAACGCAAGTTAATG
TTATCACTTGAAGTGGTGACTGTTGATAATCCACAAACGATGAATCCGGTCTTTGTGGAGTATAAACTTGTACTACCTCACGGCATGGGTCATCTCGATT
GGAAATTGCAACCTGGAAATTTCGACTGCAAACGGGGTAGGACGCCGCTATCGTTGCCTCAACAATCCCCATCCACTGAATGTGGGTCTTCTTCGGCAGC
GTTTGGATGGCTTGAACACTTCGACTTAAAACTCATCGATGTTGAGAAATCGCTTTTAGCAGCAGAAACTTCGTCCCAGGCAGCTAGAGATGCTGATTTC
GGCAACATTATTCCCGCTCCAATCCTTTATTTGAGCGTGTATTCACTGGATTGGTGGCGCCGAAAGCACACAGAGGGCCATGGGGAGATCGAATTGCAAG
GATCCTCCGGATTTTACGACTTTGATGTGCCTATCCGGAAACCGATTACTTCCATTCGTGATCACATGGAGGAACTTTTTCTTGGCATCGGTGACAGTGA
CACCGACCAAGACTGGAATGCAGATCGATCC