Description :
From Genome Similarity Track
Location :
contig_32:657279- 658650
Transcript NameFunction/comments
g7428.t1hypothetical protein

Sequence
1371 bases(100 bases per row)
ACCCCCACACGTTTTTTCTATTGCAGAAGGAGCTTATCGGTCGCTGAGGCGACGACTGCACGAGCCTGGAGAGAGCAAGAAGAACCAGACGATCCTCGTG
AGCGGCGAGAGCGGCGCCGGCAAGACAGAGACCACCAAGTTTATCATGAATTATTTAGCAGAGAGCAGTCGGGACTCAGCAGCGACCAGCAGTAATAAGA
GGAAGCGGGCGATCAGTGGCAGTGAGTTGATGAGCGCGAACCCGATTCTAGAATGTTTCGGCAATGCACGGACGCTGAGGAACGACAACAGTAGTCGATT
TGGAAAGTTTGTACGCATGTTCTTTGATGGACACGAGTTGGATGCGTCCCTGAGGATGGTGGGCACGTCCGTGGAGACGTACCTTTTGGAAAAGGTGCGC
GTGGTGCATCAGAATGACGGCGAGCGGAATTTCCACGTGTTTTATGAACTGCTGGCTGGGGCGGATGATGCTATGAAGAGCGAGCTGCATCTCGTAAACC
TCTCAGCGCAGGAGTTCCAGTACATCAATGGTGGACAATGCTTCCAGCGCAACGACGGCGTGCGTGATGATAAACAGTTCCAGTTGGTGCTCCAGTCGAT
GAAAGTGCTGGGGTTCACGGACGTTGAGCGAGGAGCAATCTGGAAAATCTTGAGTGCGCTGCTACATCTTGGAAATGTATTGTTTGTTTCCTCGAGCGAG
GATGAGGGAGAGGACGATAATGGAACGGCGTCAGCACCGTGTCGACTCGCCTCTTCATCACCTTCGTCGCTTACTGTTCAGGAGCATCTTGATATCGTAG
CAAGGCTTTTTGCTGTGGATCAGGAAGAGCTGGTGTCGGCGCTCACGACCCGAAAAATCAGTGTTGGTGGCGAAACTTTCCATTCAAATCTGAGCCTCGC
GCAGTGTGGAGATGCTCGAGATGCAATGGCTCGCTCATTGTACTCGTTCCTTTTCCAGTTCTTGGTCTCAAAAGTAAATTCAGCCTCGCCACAAGTCGCA
CCACCTCAAATCCTGCCAATAAAACAACGAACAGGGATGCAGCACCATGTATTGCAGTTCTGGACATCTTCGGCTTCGAAGAATTTGTGATCAATCAGTT
CGAACAGTTTTGCATTAATTACGCGAACGAAAAGCTGCAGTATCAGTTTATCCAGGATATTCTGCTCACGAACAACAGGCCCATATTGAAGAGGGGATTA
AGTGGAACGCTGTAGACTACGAAGACAACTCATCGTGTCTGGAAATGGTAGAGCAGCGCCCCAGTGGCATTTTCTCGCTCCTGGACGAGGAATGTGTTGT
TCCAAAGGGCAGTGACGTGGGCTTTGCGCGAAAACTCTACCAGCGACTCCAAGAACACAGCAATTTCAGTG