Description :
From Genome Similarity Track
Location :
Scaffold_958:6572- 11442
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_958-fgenesh-gene-0.1(Fragment)
Pytar_ATCC12531maker-par_contig_958-snap-gene-0.5RapGAP/RanGAP domain-containing protein

Sequence
4870 bases(100 bases per row)
GAAAACGCTGCGCCTGCTCACGCTCGATGGCCGCAACGTCGAGCCGTTCCAGGCCGAGCTCGGGTGGCTCTTGGTGCAGTGGCTTGAAGAGTCGGACGAG
CAGCGCGATCTCTTGCACCTGATCCAGCACATACTGAAGCGAAGCCCCCTCATGCTCGAGTTCGAAGCCGTGATTGCCATCACGAGCATGGTCTGCGGGC
GCTGCGATGTCGCCATGTCGCGTCGAGAGATGGAGACCTGCAAGCGCTTCCTTGCGTTCTTCCACGTGCTCGCGACCCACGGGCTTGAGCACGCGCTGGG
CACGTCCGTGTGTCTGCGCACGCTCTGCTGGATGGTGAATCTGGACCAAGAGACATGGCTTGTCATGAAGTATCTACTCAACAGCAGCGCCGGCCTGCAG
GTTCTGCGCGGACTTGTGACGCTGCTGGAGAACCCACTGCAGCACAACGAGTGGATCCTCCGCGGCGCCGTGTTCTATGTCGGAATGTCTTGCTGGGGCT
CGCAACGCGCCGCAAGACTGGGCGAACTCAAGTGGGCTCCCATTCTACTAGCGATCGAAACGTGTCTGCAGAGCGAGCACGGCCTCGTGGTGTTTGAAAT
CATTCTTGCGATCCAGCGGCTGATCAAGAAGTTTGGCGACTCTAAGCCGGCAGCAGCTCCACAGGAGGTTGGCCGGAGTGCTGACACCGCGAAGCCATCG
CCGTCGAAGCGTCTCGTCGTCGAGTGGGATATTATCCTACGCATGTTTCGCACGCTACGGCCATGGCTGTCGAGGGGCGAGATCACGGCGAGCCGCGTTG
TCGTTCGACAGGGCAGTGGCGGTAAGGTGATCAAGCAGAACATCACCGCCGCGGCCGCCCTCACGAGATCGAGCTCGGGTTCCGCTTCGCAGATCCCGGC
CGATATTCCTGTCCACATGACTCGAATCCCGCAAGAGCTGCTCGACACATTGCAAGTGGTGGTCGATCTCGTGCGTACTGGTAAGTTCACTGGCGAGATT
GAAGAGTTCTACGATGTGCTAGACGAGTATTTCGCCTACTTGCCCGAGCCAGCGATTCGCCTTCTGCTTCGCTACAAAGCCGAAGCGGCCCACCCGGCCC
ATCACATCGATTGGCTTCATTCACTGGAAAGCACGATGGGCACGTTCTTCGTGGATCGCCAAGTGCCAGCGAGTGTGCGAGAAGAAACGCTTGAGCTGCT
GCAGGTCAACTTGTGGTCTAGCCGAAATGTCTGTGAGGATCGCGTGGTGGAGGAAGTGCTCTTGCCGATGCTGGCAGACGTGTACGACGATCCGGAACCC
AACATTCGACGGAAGGCGCTCGACCTCATCACGGAAGTCGCGCGCACGCTGGAGAGTGTGCGCTTTGACTCGCTTCTCGAGATCCTCGAAAACGCCGTGC
AACTGTCGGTGTTTGAAGACTCGCAGCTCTGTGCCATCTCGGGCATTGTGTCGCTCTTCTCGTCCTACTTTAACCATTTGCCGCAGTCGCGAGCGCTTCG
CATGTACGACATTATTACGACTGTTGTGGAGAGCCACCGAAACTGGGAAGTGCGCCATTGCGCGTTGCGGTGCCTTCTCCACGTGTGCGAAGCCAGCTCG
GATTTCCGGCTCCAGTGGAAGGACACCAAGACGCGCACGTCCCGATTCCTCTTTTGCTCACGACGTGCAGTGCGGAACCAACAGACCGGTGCTTTTGTGC
GTGTGCAGAACGGGCTTCGCGCTCTCTTGACGTTGGTAAGCACAGAGTCGCACGCGAATCTTTTCCGTATGGCGGTCGAAGGACTCCGACGCATGCTCCA
CAACCGTGTCATCCTCACGGATATCGACATCAGTGACACGGCGATGAAGATCATATCGTGTATCGACTACCAGGCCTTTGGACGCGCGGCCATCCCGGAT
GAGCTACAGACATTCTCGGTCGAACTGGAAAAGGAGTCGGCTCTTCAGGGCGCTGCATCCAGTCAGGTCGCGGAATCAGTGGACAGTGGCGGCAGCAACG
GGTCGCGGCCTGCGCGGAGCCACACTGCAACGCGCATCAATCTGCTCGAGATCAAGTCGAGCTTCCGAGAGGCGGCTGCGCTGCTGTGTAAGATTCGATT
CACGACCATGGGGCTGCAGCTGCTCGAGTTGTTTGTGAGTTATATCAGTGAGCTGAACGCACGGGCTCGCCACCATCTCATGATCTGCGTCATCGGGGCC
ATCGACACGCAGCTGCTCATCTCCGACCACGATTTCATCCCCACCGTCGGCGAGGAGCACGAGACCAGTTCGACTCATAGCGGATCGGCGTGGATCTGGC
CGTCTCGACCGAGAGCGAACAGCTCCCATCGTGCCAGTTTCGGCACGGTGAGTGTCGAAGAAGCCGGGTCGCAGCCCGCCGCCCAAGTCAGTGGCCATGG
CGCGACGAGCTACGCCGACAGCAAACCGATCTCTCCGAAGGTTCCATTCACATCCCGCGTGCTCTCAAAGTTGTCGGGTGCCCATCAGTCCGGTATCTTC
CACGCGTTGACATCGTCGGCGCATGGTGGGGCAAGTGGCGACCAGAGATCGACAGCCTCAGACTCATCGGTGCTGGCAACAGCGCGCCACGAAAAACAGC
TCTTGTTGCGCTGCCTACGGCTGGTATTTGACGCCGAGTTCACGCTGCTGCACACTGCGACCAACGCCATCAGCCTACTGGGCCACATTGTTCCCGACGT
TGTGTCGGCGAGACTGGATCTGCTGCTGCGGAGTGGGACGAGGTGTTTCTTCACGCCCGACGGCTCGTTTCGCAGTGACGGCTATGCGGCTGTCCTTGAA
ATGATGGGGAATCTTGTTGTGAGCACGCCGGCGGTGGTCATGCAACTCGAACACAAGTGCCGCATGCTGGAAGATCTCGTGCTCGTGGCCTTCCGGCGAC
ACATTGACAAGGCCACGACCTATCTCGCCTACCGCCTACTGTGCGAGATCATCTTTCAGTGCCAAGACAAACAGCATCGGATATCGTTAGCGACGGCCGC
GCTTCCTCTGCTGAAGGAGTCCGCGACGCTGGCCATTACGAACCACACGCTCACGCTCGCGGAAGCGGCCGTCGACTTTCTCATGTGCTTTGCGTTGCCG
AGAACCGATCTCGTGTTGGCGCCGGCGTTACGGATCACGGATTCGGAGACCAAGCGCCACGGTGTCGACGACAAGCAAGCAGGCGTCACGCAACGCTCGT
GGGTGTATCATAACACGATCGTCACGATCGAGGTTCGACCAAACCGACCGTCTCTACTCATCGTGCGCCGCGCCAGCTCCACATCACGATGGCACTTGTC
CATGCGTCAAGACTACATCTCCGACCTGGACCCATTCAGCCTTCGGCCGACCAAACAGGCAAAGCCTTTGATCAGGAAAATGTCGAGTTTAGCAGGTCCC
GAGAGCAGCAACCTGCGCCAAAAGGCACAAGCCCCGACAAATGGAGATGGACTCGACACTCGCGATGCCGCAGTGAGGAGTGATCGGCGATCGCTTGATC
GCCCACCACAAGTACCAGGACAGGTGGTCCAATCACGCGCAGCCGACAAGCCAACTGATCGAAGACGAGCAAGAGCCTCGCCAGCTCGTACATCGCCTCC
ATTGTCCAACCGCAATGACTACGCGACGCTTCCTTCACGCCATTTGCCCGTGCCACCGCTACCAGCGTACGATGGAATCGGTGGATCGCCGTCCTTCTTC
TGTGAGACGACGCCCGCCGAGAGTGAGCCCGGGGCTACGGATGCGATGGAGCCAATGCTTCTAAGTGACTCTGCTCACACAAGTTCTGATCCTTCTCAGG
AAAAAGATGAATCGAAACGGCTCGGAGGAGACCCTACCCAAGCCGAGTCCATTGGTGAGGACAGGCGAGACGCGATGTCCGGTGTGGTGAAGAAGGCGGA
TCCATCGGCAGGCGAAAGTGAAGGGGTGGCCGGCCCCGCGACGACCTCGCCTGGTGACTCCGCCTCTGCGCGTAGTCAATCAACTGGTGATGATGAGGCT
GAGGACAACACACCAGCAAGTCGTGAGTTCGATCCCGTGTTCCTGATGATGCAACTCTTTGACCTGGGCGTAGAAGATCGACCACAGCTTCTGGTGAATG
GACCGTCGCTTGCGCTGGGCCTGAACGTGCTGGATCGCACGCCCGAGTTTGAGACCCACAAGATTGGCGTGCTGTACCTGCGCAGCAGCAAGCGCAAGAC
CGAGGTCGAGCTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGGATGGCAAGTGCATGCTGCTCTATCGCAGCCATTCGCTACAGGTAAGGAAGCTTTCCCGCTCGA
ACGTAGCTCTTCAACTCTGAGGTACTAAAATTCGTGTGTGCTAGATGGTGTTCCACGTCGCGACCATGATGACGGCACACGACGGTCTTGAGACCGAGCA
GCTCGACACGCCGAGCGACGGGACCACACGCAGCGACCGCAAGTACTCTTCTACGACCATGAAGAAGAAGCGGCACATTGGCAACGACTTTGTCCACATT
GTGTTCAAGGCAAGTCGGGGCCATTTGTTTTCTCCACTCGATCTGGATCCGTTTCGCTAACTGATTGTGAACTGTAGGAGTGCGATGAAGATTACGATGT
GCAGACATTCTCGGGCCAATTCAACGACGTCCACATCATTGTGCAGCCTCTGAACGACCTCGAGTACCGCACACGCGTCAAGTGCAAGCCCGGCATCGCG
CCGTTCGGCCCGCTGTACGGCACGCAGATCATCCCCAGCTCACTCGTCGCCGTCTGCGTGCGACAGACCG