Description :
From Genome Similarity Track
Location :
Scaffold_76:65718- 69388
Transcript NameFunction/comments
Phypl_g2529conserved hypothetical protein
Phypl_g2530conserved hypothetical protein

Sequence
3670 bases(100 bases per row)
ATGAAATATCTAGCGACGCTTACGTGCAGCCTCCTCTTGCAATAAACGAAACCCTCGAAGGTACTGGTGGCACTGCGCGGCGGTGTCTGTCTGTAGGTCC
AGAGTGCGGCAAGGGTGCACGAACACGAGAGAGAaacagcgagctggagcgtcAGGTCGCTGGCGAGCAAAGGTCTCAGTAGTAGCACCGGGTAGCACCT
CCACGAGGTCGCAAGTGTCGACTTTGGCGTCGGCTTTCGGTTGCGTCAGTGAGCTGTGGGTGACCGACGCCGCAGGTGAGCGCCATGACAACCAGTGGCA
CTGCGCATCTGCATacacgacgcgctggtgaGGCACACCGCGCGCCCCGAACTTGGTTACAACAATGCCGTTCTCAAGTTGTCTCTTGAATTGCACAAGA
AACTCCTGCTCTTTTTCTTGAGCCTCTGCACGTGTCTGACTAGCGCTTTCTAACGCGTCAACTGCCACCTGAAGCCGATTCTTCTCTGTGCGCTCGTCCT
GGCAGCGCTGATCAAGCTCGCGTATCTGACGCTTCAGATCATTTTGTGCGGtttgtgcttcttgctccACCTTTTTGCGGACAACCTCAAGTTCAGCACC
GAACTCACCTCGCATATTGCGCTCACGGTTCTGCGCGTCTCGTAGTTCTTCATGCAGCGAGGCCAGCAACTGCTTGCTCGTAGTATTCACTAGCTCCAAG
GCGCGGACTTGTTCCTGCAATTGTTGTAGTTGCTGGTCATGGCACGATAACTCCACAAGTAGCTCATCTCGGTGCTGGTTCAAGTCGGTACTAGCATCCT
TCAGTCTCTCCTGTAGTGGCCtgctagctgctgctgtattCGGCTCAGTTCCAGGCTCTAATGTCGGATTCTGCTGGGTAGATTGAGGAACCGCGGGAAG
TTCGGCAATGGGAAGGCTTTCTTCTGCTGGTGGAGCCATTGCCGAGCGCGAGTTGGCGACTTCAAGTGCAGCCTGTAGCTCTTTCACATGCTGGGTTTTA
GCTGCATGAGAGGTCCTAAGCGCCGCAACGACAACCTCAACTGCACGatgcgctcgctgcgcgtCGACAAGGCGGTCGTGTAATTCATCTACTTGGTTCT
GAGTATCACGGTGCTCCTCTTGCAACTCCTGCCACTGCAACGCTAGCATTTCTTTATCATGTCGAAGCTGATTCACTTGCTCTCGGCTTTCTTCTGCGGC
AGTGGCCTGCtctgcgagctgcgcctGAAGATCCATCAGCGTATGTTCTAGTTCCGCTTGGTGGCGGTGTAGTTGTACCTGCTCAATGTTcaccgcttcc
agctcggctTGCGTCGTCACCGACGCTCGCTTGTGCCTTAGAAGGAGCTTGTTGACCGCTACCATGTCATCGCGTTCTCGCTGCACTTTGCGAGTCTCCT
GCAGCAATGTTTCCAGTTGACGAGCTGCTACTTCCTGCTCCCTTTTCACTGCTTCTTCACGTTCCTGATGCAACGCGCTCAATTGCTCTCTCACAGTGCT
TAGCTGCTGACTCACTTCAAGATACTCCGTTTTCAAGTTATTCACCAAAGTGTCCGAGCCGTCTGCATCTGAACCTGTAGTTTCAGGGAGCTGAAGTCCG
TCACTTTTGATTTCGAGGCTGGCTTGAGTATTGCGGCGAGAATTAGGGTTCCCTTGCCTCATCGATAAACTGCTCCTGCGCCGAGTCTGCCGCAGCGGAG
CAAGACTTCCGAGACTCTTTGATCGCTCCTCAAGGCGTGCGTTCACGTGTCCAGAACTAACATCGGCCAGAGTCAGAGTCAGAGCCGGCTTCGCATCGCG
CATCCTAAGAGTAAACGGCAAAAGCCAAAGGATCAGTACTCGGTTATCCTAACCAAAACAAAACGGCATACACTACTCACATTTGCAGAACATCAGTGTA
CGCTATGTTGGCAACGTCGGTCCCATTTACCATCCGCACACGTAGCTTGTCGACAATGATGCGAGAATAGTCTCCCGCAGCCCGGCAACGCGCGTTGTAG
TCAGCTGCAAGTCCCGCAGGCGCTATATCCCGGACAACGCAAGCGTAGCTATCGGTAGGAACGAGACTTAACTTGTTGCTCTTGGATGTAGGCTGAAACC
CAAGACCCACAGGCTTGCTGCCGTCaaagaagacgctgaacTCCTTCTCCCATCGGCAGGGGTCTTCATTTTCCTTTGTTCGAAAAGTGGCTACCAAAAA
GTCATCCCATGCTCGTTCCGCACGAGATCCTTCAGCAGTAGTACCCTGGTCCTCGTCGGAGTCGTGGTTGCTCAGAGGCACCGCAGCAGGCTCCACACTC
CACGGCGGACTGCAGAACTTAAGCACCATACTAGCTGCCTGCACCCACGTTTTCGCCGCCGTCTCGCTAGAGCAGTTGCAAACGGATTatgagcttctgc
tggaagcgagAGATCTCCACGATGACCGGTTCATACATACATCCCCGGTTTAGACGGCATACTCTCACAACTAAAATAGCACTGAGGCAACTCCAAgggt
gtgctgctgcacacgacATCAACGACCACCAGCAAAAAATAACATGTTTAAGTTAGTGAGAGGGGCTGAGACGAGAAAAAAAATCAGCTTCGGCTTCACG
CCTGCGTTTGTATCTCCTGCTTCGTTCACAGTTTATTCCACTTGGTGCCGTGACAGCTAAAACTGCGGAGAGCAGCCAGGCACGCGGCAGGTTGCTCCGG
TTGTACAGGTAGATGCATGCGCTCGTACAATCGCCCCCCAAAGCTTACACGCGCCGCATCTGTTCGCATCGTGGTTCGCTTTACCTGCCATGCTCGAACG
GTGGGCTTTCACTTTGTCCACAAAAGTGCGTGTAGAAACACACAGCGGATTAAGACACccgttggcgctgcacgtcgatagatgctgcagcccacGAAGC
ATCGACTGCATctgagctgctccaggagTCGTCGCCACTGCCGTCTTGGCAGGAGGCATCTTCTTGGCATCAGATACTTCTCCGACTGATGTGGGGCTCA
GTGCATCACGACGCAGACGCTTTGCTTGCGGCGGAGCTGGGCCCTGGCCCCTGAGggacggcgctgctgtacCAGTATAACCTCCTGCCATCGAGACGGC
AGCGGAACCCCCACCAACCGGAAAAGAAGACGGCAGCGAAGCGAAGGACACCCGCGGTGGTGCAAATGCAAtgcgaggcggcggcgtcccGGCGACAGAC
TGCGATGCGAGCGAGTCGCCGCTGTGGCTGCGCTTGCGCGAGAGTCCATTGGCGACGAtctgcgagcgcgagatggagtatgacggcggcggcggacgcg
gcAGAGACGGAAACGGgtgggcggcgacggcagccaCTGAGCCAAAGGCGTCTCGATCAGCCCCGCCGTTCGTAGGGAGGCTCTGCACAGGCAAAAGACG
AGGGTGAGAAGGACCGTCCTTGTAGTTGGTGACGTTGCTGCGACTATCGAGACGCACCACTTCAGCTCCATCggccacgaggaggaggcccgccagcttc
acgacgCGACGGATCACGCGCGTCTAGACACGGAGAGGGACGTtgcgaggaagaagaggacgtCGGCTATTGGACTGCCCGAAGAAGTTCTGAGACTTGT
GCAGTATGGCACCATCACTCAGTTAGGGGTAGGGTCGTTTTGTTCCTGGCACAGTCCTTGTGGCGTTGAA