Description :
From Genome Similarity Track
Location :
scaffold_28:6570- 11494
Transcript NameFunction/comments
g3924.t1 hypothetical protein PHYSODRAFT_522429
g3925.t1 hypothetical protein PHYSODRAFT_523388
g3926.t1 conserved hypothetical protein
g3927.t1 hypothetical protein PHYSODRAFT_318537

Sequence
4924 bases(100 bases per row)
CTGGTGGCAGCATTCCCTGCTGACCAACAGTTCCAGACATCACCTGAACGACAAAACCCACCCTACCACTCCCGGTCTCAACCTCGCTCTAAATTCCGAG
GTTGAAGTTCGCTCTGTAACTCTTACTGAATAAATGCTGAATTTTTGTCCCCACGACTGGAAGTACGAAGAAATCACAAATTCTGTTTTTAAATTTTCAA
AATAACCACATTGAAGCGGCATTGCACCATCTTGGTCGGAAATTCCTCTCGTTCAAAATTAGCGGAGAAAAACAAGCTTTTTAGAAATGTCAACATTTGT
ATCTCAAGCAACTACATCTGCTTCGGTAGCAATGCGACTTCTATCGACCAAATCTAGGCTCTCTACTTACAAGTTTTCTATGAGAAACCCGTCAACGCCA
GAGCCATACGCCGTGTTGATGCTGTAGCCAGCGATAAGCACTACTGCTGCTATAACCGAGACCAAGTTGCCGATGAGTCCGCAAATGGTGGCGGCACCGA
TCAACACGAGCCAGAACATAACCAGCACGGCCATCGCAGGCACTTGATCCTGCTGAAAAAGCGGTTTTGCTCCGTCCGGAAGCTTACCATTCGACTCGTA
AAACGCCTTCAGCAAAGACTCCTTGCGTTCAAAGCGCTTCTCCACCCACGTCGCAAGCTCGCTCTCGCTTTTGTCGCGCAGCGACGAAATGTCCACACGC
TCGAGGTAGAAGTGGATCATTCGCGGCACACGACCAGTTAGCAGCGACGTCTCCGATGGACGTTCGTTTGCGGCGTAGTCCACGTAGAACATGGTAACAT
CGTATACAGCGGTGAGTTGAGAGCGCAGTAGCGGAAACATAAATGTCCAGCCTGTCGTACGCGGGTACAGCGAGTACTGACGTGGCGGCAGTCCGTTCTT
CTCGGCGAATACAGCACTCTTATCAAGGTTACTCTCGCTCAGATCCGTACCTTCTGGGAAGAGGAGGTATGAAGCCTCCGGTTCTGCCGACGTGAGGAAC
GGCAGCAACTTGCGCAGGTTCACTTGGTCATCAGCCCAGCGGCGTTGCTGTAGAGAGCAGACCCCACGTTAGCGCCTCACTCTCATTGCTTCCTAAAGTG
TAGATGTTACCAGAAATATGAAGATGAAGTGCTGCATGGCCCAGCCGAAGATGGGGATTTTGCGCAGAGGGGCCTTGAGGACGATACGCAACTGGTGCAG
CGTACGCGTTCGCCAGGCCACACTCCACAGCAGCATCCAGTCGATGCGAGTGCGGTGGTTCGACAACCACAGTGCGCGGTCTTGCGGCATGTCGCTCTCG
TGAGCTTTGGTCTCGGCGTCGCCGTAGACCTGCACCTGGATGCCAAACAGTTTCTCTGGCAGAAGTCATAGTGAGCGTCTCGCACTGCCAACGGCTTCTA
TAATACTTGGAAGTGGCAGATCCACGCACCCAGAAGCAGCACGACTTGACCCATCCACGCCCATTGTCTGCTCCAATAAACACAACAACAGCTCATTGAG
TAACAAACCTCCCGTCATCCTTTGTTGGGATTCCACCGACGCACATGCAGCGAGTGACGCGGCGGTAGAAGCGTTTGGTCTGCAGAAACGCCGGCAGAGG
CAGGGCCGCGAGCACGAAGCACGGGGTCAGCACCCACGCTAGGGCTGTCCAGCCCGTGAGCGCCAGCGATACCAGGAACACGACACCCACAACGGACACT
CGCATGGTCTCCGTTGCTAATTCTCAATTGATACCATAAGCATCTGATCGTAAGTTATAGGCTTATCTCCTAAGATATGTGATACATATATTTATACAGC
CTTAGGAGATATGTTACACTGTATATCCACTCGCCTTCTTCAAGATTCATTTTAGCTTTGGAGAGGCAGAAAATGACGACGAGGGAGGAAGCGGAGCGCG
ACGTGAAGCTCCTCGTGAGCTTCGTGGCCATGGTCTTCGTGGGACTCGGCAACAAGAGTGCGTGCTAGTCTCTAATCTGCACAATAAGGTTCTTGTACGG
CTTAAAATCTCCCAACTGACGCACTGTTCTCCGTCCTGGATGAATCATTCTCTGCTCAGTCTTCCAGAAGTGAGTTTTGCTACACTTGGGGTGCAGCTTT
ACTTGTGATTCGTATACTTAACCGATGACTTTGATAGACTGCAGACCATCCCGATGCACAACTACCCGACGTTCCTCAACCTGCTCACCACGTTCGTCTA
CGTACGTGCGGCCTTCGAGTGCATGCTGTACGCTTTACTAACTGGGTGTTGGATACACTGCAGATCCCCATCAGCTTCGCGTACATCCTACCGATGATAA
AGTATGGTAGTGCCATCACGTGGGACCAACGCAGCATCCCGAAGCGGAAATTCGCCGTTATGGGAGGACTCGACTCAGTCGCCGGCATCCTGCAAGTGTT
TGCAGCCACCTATCTGGGTGGATCGCTCATCATCTTGCTTGGACAGGCTGCGATCCCCATTTCGATGTTGATCTCCAGTCTGTTGCTGAAAGCCAAGTAC
TCGGGCTACCAGTATGTTGGAGCTATGGTCGTGACGCTGGGCTTGCTGATTGTACTGGGGTCGGGCGACTCTGGCAGCAGCAGCGGCACCAACCCGCACC
TCATTGTGCTGTGGTCTGTTGTCATGATTTTCAGCTGTGTCCCCATGTGCCTGTCCAGTGTATATAAGGAGAAGACTCTGGGGGAGGCAGAGCTTGATGC
GGTCTATCTGAATGGCTGGATCGCAGTGTTCCAGTTTCTGTGTGCTATTCCACTGACGTTCCCGGCAGCAATGGTTGGCGACCACCCAGTCACGCCGAGT
GAACTCCCGGAGAATATGTATGACGGCTTGATGTGCTACTTGGGGCAGAACACCATCACTGAAGGCGCGCACAAGGATGACTGCGAGAAAGCGACCATCT
ACGTGACGGCCTATTTGCTGTTCAACGTGGCGTACAACCTGCTCATCATCTTGATCCTCAAATTCGGCAGCGCCAACATCCTTTGGCTGGTAAGATCCTG
TTGACATTTGGCCATTTGATCACATGAAGTAGCTTTCTCTGACCGTTCTTGTGTTGAACAGGCCATGACCATTATGGTTCCACTGGGCAACGTCGCGTTT
ACGTTTCCGTTTATGCCGGAGCACCAGCCTCTGCACACAAAGGACATTGCAGGCTTGCTGTTCATCATGCTGGGGCTGTTCGTGTACCGCTTCCTGGAGG
AACTTATGGACTCTTGGAACAAGCGGAAACCCGTGTACCCGGACGAGAAGGGCCCGGCCGTAGACGAACTCAAGCGGGCGCTCATCAGCAGCGACAGCGA
CAACAGCGATGATCAAGAAGTCTAAGTAAACGGCATACAGTTACGGGTGCACTTTGCAGTGCCCGCCATTGTTAACGAATGAAAATCTATGAGACGTGTT
ACGTGTGCTAGTACTCGAAGCCCACTGCATCGTGCTGGTACAACTTACTTGACTTCAACCCGTCAAAGTGCTGTACGCACACATATAGGGGTTAGGTGTT
ATGTACACCACACGCTCCACGGATGGCTATCGCTTATCGACCGCAGAACCGGGAAGACCACCACTGCACATCGCTGAGCATGCTGGCCGCCGCCACCAAG
AGCTTCGTGCGCGCCGCGGGCGCCGCCGGGTCGCGCCGCGTGCCTCTTTTCAGTGCGCAGGTGTCTCTCTTCTCCGCAGAAGCTTCGCCCGCCGCGCCCG
AGCAGCCCAAGCGCGCCAAGCTCAAGATCCCGACCAAGCGCGCGGCGTCGCTGCTGCTGCAGCTGGAGGCGGAGGCCGTGGCCAAGGCCGCCGAGGGAAA
GGACATTGACAACTTCAAGCCCGGCGATTCGGTGGAGGTGCAGTACCTGCTGAGTCGCACGGGCGCCCGAGTGCAGCGGGTCAAGGGCGTGGTGCTGGCG
CGGCGAAACCGCGGCACGGGCAGCTCGTTCGTCATCCGCAACGTGAGTTTCGATGCGTTTACGCTGCAGCGGTGAGAGGCTAATTATCATTTTATTGTTT
GTGACAGCACATTGGCGGCTACGGCTACGAGCAGAAGATCTTCCTGCATTCGCCGCTGCTGCAGAGCGTCAAGGTGCTGCAGGAGGCGTTCATCCACAAG
GGCAAGAAGCGCGTGCGTCGTGCAAAGCTCTTCTATCTGCGTGAGAAGGCGCCCAGCTTCACCACCGTCTAGGCGGTGCGGCTACGACAGACTCGGCGGA
ACCAGCAACGAAGTCGTCACAGCTACCAGTCGTGCAGATGTCTGGATGGAGGTAGCAGCGCTGCTGGTTAGATGTAAGCGGCACGGGTAGGGGGGTGGTA
GCAGCACTTAACACTAGAGAAGAAAAACGATTCACAGACCACAAGCTACAGACAGGAACAGGGTCGTCTGTTATCGGCAAAGGGCAGCTCGTTTAGTCAA
GCCGCTGCGACTGGGGCAGCAGCTAGTATCTTGGCGCTCCCTCTATCTGCGTTTCTTCTTCTTGGACTTGCGAATGCCAGAGCCGCTGGACACCACGACG
GCAGCGGGCTTGTCCGACTCGGCCTTGCGAGCAGCACGAGCGGCTGCATCCAGCTTGAGGGCGTCCTTCTCCGTGCCCATGCCAGCACCCTGCGCACCGA
CAAAGCGGTTGCGGCCACGACGGCCGCGCTTGCCGTGAGAGCGCTGCTTGCGTGGAATCCAGCGCTCCGGGTCCGGGTTCACCAGCCCAATAGACGCGTT
GTAGTCCGGACGAGCGCGCAGGTTGGCCAAATGAGTCTCTCGACGCTTAGCGCGCTTGCGAGCGATGCCCTCCGGGCTCTTCGCCGCACGTTTGCGCCTG
TAGGCAAAAAGTGAGGTCAACATCTATGTAGAGAAACAAGCTAGCAACACGGTGCCCAATACGTACTCGTTCTTCTTGTCACCAGTGTCGGCAAACTTGG
CGGCCAAGCGGTTCGAGCGCGGGG