Description :
From Genome Similarity Track
Location :
Scaffold_903:6570- 7592
Sequence
1022 bases(100 bases per row)
CCTTGATTGAACTCGTAGAGCAGGGCGCCACAGTTGAGCTTCGACACAGGCAGCCACTCGGCCTCATCGTACCCCTTCCACTTTACAAGGTACTCGCGAA
TACGTCTCGCTGTCCGGGTCCGCTTAGTCCAGCGCAAATCCAGGATTCGCTCAACTTCGTACTCGTCGTTCGCAGTGTCGGGCTCCCAATTGTCTTCAGG
CAGCAGCGCCGCATCAAAGTCATCATCCTCGTCCACGTCGATCTCCACAGTGGGTCGCTTCGTGAATAGTGCTCTGGGTTTCAAACAGCTCACGTGTACC
CAGGGGTTCACGCGATACCCTGTGTTCTCGACCCTGAGTTTCACGCGGAAGTTGTCATGGATTTCCTGGATTCTGAAGGGACCATGCCACATGTGAGCCA
GTTTGCGGCTCAGCCCGGGCTGCACCTTCGGTATATACAGCCACACAGCCACCCAGCATCACCGACTGCGAATCCTGCCTTCAGTCGTTCGGACAGCTCT
CACCACTTCCTGGTTTGTTCGGCAGAGCGCGCCCGCTTGGCCTTCTTCTGGAGATTCTCAGCGCAAGCTTGTGCATAACTGTAGTCACGCTGTAGCTTCC
TGGGCCACTCGTACGCGGTGCGCTCCTGGATACTTGAAGGCCTGGGTCCCAGCATTGCAGACACAGTACCGTGTGCGTCCTAGCCGTGCGCCAGAAAAAA
ACGGAGTGTCCAGGCGAGTGGCATCGAACGATGTATTCAGGGCAAATATCAAGCGCTCAGCATGGTCGTCCCAGTCACTCTGGTCCGCTTCTGCAATGTA
CGCTCGAATGCTGCGCACGACGGTCTGCACCGACCGCTCTTGCTGTCCGTTCGCATGGGGGCGGTACGCCAGAGTGGCCCGCTGCTTTCTACCCAGAAGT
TCACGGAAGCGCGTGAACACCTCACTCATGAACCTTGGGTCTTGGTCGTGCCTCAGCATCGAGCTCGCGCCGAATCTCCTGAAGGCCTGCTCTTCGTACA
TTTCAGCGACGTCTTGGGCTGT