Description :
From Genome Similarity Track
Location :
Scaffold_582:657- 2055
Transcript NameFunction/comments
Phymu_g10978hypothetical protein PHYSODRAFT_531337

Sequence
1398 bases(100 bases per row)
TGGGTGCTGTACGCCAATGTACTGGTGTCTTTGCTGCAACCGCTACAATACGGATGGTCTACTACCCAACTAAACTTGACAACCTTCAACAACGAAGACG
AATGTGATGCAAGACCAGTTGCCCGAGGTACGTGCCTAATGTTCCCGGGACACACCAAGACCCAATGGACCATCGCCGTCAGTGCCTGGATCTTAGGCGG
CATGATCGGTGCTCTGGTGATCGGCCGTTTCTCCAATATATTCGGTCGAAAGCGCATCATGATGatcaactgcttcttcatgattGTTGGCGCCGCGGTG
CAAGCCAGTGCTTCGAGCATTTGGATGTTTATCGGTGGACGAGTTATCTCCGGTATCGCTTCTGGTGGAGCTACTGCTGTCATTCCTGGATTCATCAGCG
AGATTTCACCACCAACACTCCGTAACAGCCTCGGCGTAGGCTTCCAGATCGCCATTACGGTCGGCAATTTATTGGTtgccatcaccttcttcttcgccga
CACGAGCAGCGGTTGGCGTTATATTGCCGGTTTCCCTATCGCGTTGGCACTCCTGTTCTCGGTACTGGCACCTTTCGTGGTGGTTGAGAGTCCTGCGTGG
TTGATCATGATGGGGAaacaacgccaagcagaacgagaaCTGGCGAGACTCTACGGCGAAGAGAACGTTCATTTGGCTAAAACCTGGTTCAAGCATGGCG
ATGACCCGACAGCTCGTGTTGCATCAAGCAGTGAGTACGTCTCACCACAGCACAACACCAACACACAAACCCTTCCAAAGGTGAGTAGCTTCGCCAAATT
GTTCTCGCCCATGCTCATTCGACAGCTTTTCACAGCTATCGGCGTGGCCGGAGCTCAACAACTCACGGGTATCAACGCTGTCTTCTTCTACTCCTCCACA
CTATTCGAGCAAGCCGGTATTTCGGATGACCGTATCGGTATCGTGGCTGTTAACTTCGTCAACGTGTTACCCACCATGTTTTGTGGCATGCTAGCAACGC
GTCTGGGCAACCGCAAACTGATCCTGTACGGGTTGGCTGGTATGTTTTTCAGTGCGGTGGGTATCACGCTTTCACTTGTTGCTagtcttccagctcttgc
cATTGTGTTCACAGCGTGCTACGTGACGACGTTTGGGTCGAGTCTGGGGTCGCTGGCGTGGGTCGTCATGGCGGACCTCTTCCCTGACGACATGCGAGCA
GTGGGGAACTCTGTGTGCGTGGGCTGCAGTTGGCTGGCGAACCTTGCGGTGGGTCTGGGCTATCCGTacattgctgctggcttgGTGAACTTCAGTTTCA
CACCGTTCATGTGTACGGTTGCATTGTCATTCTTCTTTGTGTATACGGTGGTGCCTGACACGTCCGGCAAGACAGTGCAGGAAATACAGGACCAGTTC