Description :
From Genome Similarity Track
Location :
Scaffold_608:6569- 8450
Sequence
1881 bases(100 bases per row)
TTACCTCCCGATAGGGGCGTACGTCATGAAATTGAATTGGTTCCTGGAACCAAATACTGCGTTACACAGCAGTTGCCTTTACCAAAGGAACAATGTGACG
TCATTGACGAGTTATTCGGTGCTAAGCATGCGGCGGGAATGGTGCGGGAGAGTAAGCCTCCTCATTCCACACCGACATATGTGTGAAAAAGCCTAATGGT
AAGTAGGGTATTGTGCACGCTTATAATAAGCTTAATGCGGCCACTATACCTACACAAACACCCATTCCTAGAAAGGACGTTCTTCATAACAACATGGCAG
GATGTACAATGTACAGTGCAATCGACCTGGTCGATGATATTATCAACTGCTCATGCGAGCAAGTGATATATCGCTTACAGCGGTTAGTACTCCAAGCGGT
ATGCTTTGGGAGTGGCTGGTTATGCCCCAGGGGTTTTCCAATGCCCCGGCTACGTTTAATCGTCTGGTGACGCAATTGTTCCGCCCTCACTATGCACAAA
CATATTTCGATGACACATTCGTCCATAGTCGGGCGGAACAGGGTCGGTCGGACGTGTATAACCACATCAACCATTTACGAGCTGTGCTCGAGTGCATGCG
CACTAATAAGCTCTATGCTGATGCATCGAAATGTATATTTGTTGCGGACGAGATCCCATTTTTGGGATGCTTCATTGGGAAGCGAGGCCCTCGGGCAGAT
CCTGCAAAGGTGAAGGCCATAGTGGATTGGCCAGTTTCTAAGAACCAAAAAGACCTACGCAAACGGCTTGGCCTTGCCAATTACTTGCACAAGTATAGCG
AGAATTACGCTGATATGGCTCGGCCATTATCCAATCTCCTTAAAAAGGATGTGGAGTGGTGGTGACTAGCAGAGGTTTTTAAGGCCGTAAAGGGGAGTCT
TCTACATGCCCCGATTTTGGCTTTGCCAGATTCTGATCGGCCTTTCAGTGTTTCCTGTGACGCTTCGGACTTTTTCATTGGCTGTACTCTGTTGCAAACA
GATATTGAGGGACGTGAGCGTGTCATCGTTTTTGAATCCCGTCAGCTTAAAGCTGCTGAAAAGAACTATCCAGTTCACGACAAGGAGCCACTTGATATGA
AGTATGCTCTAGTCAAATTCAGAATTCATCTGCTTGGCTCTAAGCCTTTTATAGTCTATACCGATCATGCGTCTTTACGCACGGCGACCCAATCGCCTCA
CCTTTCGCAGAGGATGGTCCGTTGGCTTTCATTATCTGCAGAATTTAACTTCGAGGTGACGTATAAGCCGGGAAAGCAGAATACGCTGACTGATGCACTG
TCACTACGGTCCTACTATGAGCTTGCTCATGTTACGATTTTGTCGTCGTCAATTACTAACTTTATCCGTTCATCTTATGCCAAGGATGAACAATGTGTAG
CTTTGCTACGTGATCTTTTTTTGAAGCGATGAGGCTAAAGACTCGGGCATTAATTATCGGCACGTTCGCGTGCGAGGCTACATCAATATTCTATCGATAA
CGGCTTGTTGTGCTATCGCACGGATGCCACGGATACACCGCGTACCATTGTTCATCATGATGAGGAACTGAATTATCGTATCTTCTATGAGGTCCACGAA
TCAGCTATCAGCGGTCATCTAGGTCGTGAAAAGACCTACGGCTTGGTTAGCCAGAGTTATTGGTGGCCCAAAATCTATAAAGGGGTAAGCACTTATGTTC
GCACATGTGAGACGTGCCAACGGGTCAAACCTTTGGCACATGGGACTGCGCGGCTGGCTATTTTTCTGTACCCTCTGGGTGTTGGGGAGTCCATCAGCAT
CAACTTCGTGTTTGGACCTTCCGAGGGATTCGGATGGCAACACAGGTATTGTGTCTTTGGCCTACCGTTTGAGCAAAATGG