Description :
From Genome Similarity Track
Location :
contig_32:656882- 658242
Transcript NameFunction/comments
g7787.t1hypothetical protein

Sequence
1360 bases(100 bases per row)
CTGGCGGACGTGGAGAACCTGGACGCTCTCACGCACCTGCACGAACCCGCTTTCGTGGACTATTTGGCGCAGCGCTACGGCGTGGACCAAGTGTACTGCC
GATCAGGCGCGGTGCTCATCGCCGTGAACCCGTTCAAAGAGATCGAGGGTCTCTACAACCTGCAGAAATACCACGATGAGATGCCCGGCTGGACGGCGCT
ACCCCCACACGTTTTTTCTATTGCAGAAGGAGCTTATCGGTCGCTGAGGCGACGACTGCACGAGCCTGGAGAAAGCAAGAAGAACCAGACGATCCTCGTG
AGCGGCGAGAGCGGCGCCGGCAAGACAGAGACCACCAAGTTTATCATGAATTATTTAGCAGAGAGCAGTCGGGACTCAGCAGCGACCAGCAGTAATAAGA
GGAAGCGGGCGATCAGTGGCAGTGAGTTGATGAGCGCGAACCCGATTCTAGAATGTTTCGGCAATGCACGGACGCTGAGGAACGACAACAGTAGTCGATT
TGGAAAGTTTGTACGCATGTTCTTTGATGGACACGAGTTGGATGCGTCCCTGAGGATGGTGGGCACGTCCGTGGAGACGTACCTTTTGGAAAAGGTGCGC
GTGGTGCATCAGAATGACGGCGAGCGGAATTTCCACGTGTTTTATGAACTGCTGGCTGGGGCGGATGATGCTATGAAGAGCGAGCTGCATCTCGTAAACC
TCTCAGCGCAGGAGTTCCAGTACATCAATGGTGGACAATGCTTCCAGCGCAACGACGGCGTGCGTGATGATAAACAGTTCCAGTTGGTGCTCCAGTCGAT
GAAAGTGCTGGGGTTCACGGACGTTGAGCGAGGAGCAATCTGGAAAATCTTGAGTGCGCTGCTACATCTTGGAAATGTATTGTTTGTTTCCTCGAGCGAG
GATGAGGGAGAGGACGATAATGGAACGGCGTCAGCACCGTGTCGACTCGCCTCTTCATCACCTTCGTCGCTTACTGTTCAGGAGCATCTTGATATCGTAG
CAAGGCTTTTTGCTGTGGATCAGGAAGAGCTGGTGTCGGCGCTCACGACCCGAAAAATCAGTGTTGGTGGCGAAACTTTCCATTCAAATCTGAGCCTCGC
GCAGTGTGGAGATGCTCGAGATGCAATGGCTCGCTCATTGTACTCGTTCCTTTTCCAGTTCTTGGTCTCAAAAGTAAATTCAGCCTCGCCACAAGTCGCA
CCACCTCAAATCCTGCCAATAAAACAACGAACAGGGACGCAGCACCATGTATTGCAGTTCTGGACATCTTCGGCTTCGAAGAATTTGTGATCAATCAGTT
CGAACAGTTTTGCATTAATTACGCGAACGAAAAGCTGCAGTATCAGTTTATCCAGGATAT