Description :
From Genome Similarity Track
Location :
Scaffold_12:6568- 8653
Transcript NameFunction/comments
Phypl_g508hypothetical protein
Phypl_g509glycoside hydrolase, putative

Sequence
2085 bases(100 bases per row)
GCGTCGGCCCAGCGGACGTACTCGGTGCCCAGGGGTCCAGCGTTGAGCACGGTGCCTCCCAGCACGGAGGCGTTGACTTCGGTGGTCATCCTGCGAATGC
TTTCTCTCCGTGTGTACGCACACACGCGCGCTGTGTCTTGGGGAGCTGGGGGAACGCTTTACCGCGGGCTCTGGGCGATGCTTCCGAGGCCAGTTGACTG
GGCGTTTGTATGCGACCGGCTTCTCCAGGGGATAGGGTCACACAACCCAATATATTATCGCTCATTTTGATTCATTGGTTTGACGTGGACCACATCGTGC
ATAATACTAAACGTCTACAATTAATTGACCGCGCCACTGCGAATTTGAATTTTGAAAATGGACGGCTTTGGGCTCTAAACGGACACGAAGGCTCTGCGTG
TGGGAGCAACATTTGCTTGCGAAGCTTAACATTAGATAATAAGTTAGGTGTGCTCGAAGGAAGCGAGGCTACAGTCGGGCGAGGCGCCTTACTGGCAACT
GACCTCAGGCGTGTCCATAGACAACatcgacgccgtggacgccgttGACCCGCCACTGCACTCGCTCAGACTCCTGCTCTTGCGCGGAGTGCTGGCCACC
TCCCTTGCCAAAGCAATGTGGTTCCTtcgcttgagcgcctccacACGGCCCTTCATGGTCTCGACCTGTCCCAGCCACcgctcgttcttctcgaaGTCTA
GCAAACGAGACGCCGAGTTCTCGATCCGGGACACGAACGCGGCGTAGCTCGTGCACGGGGAACGGATGCGAGCGGACATGGGCGTCGGTGGGGGTGCAAA
GAGTGGCTGACGCGAGTCATTTGAGCTAGAAGAAGACGTGCGGCTGCGTGACGCGCCTTCCGAGGAGGGTTTCCGCACCGAGCAGGCCGCGAGGTGGAAC
TCGCGCGACTTGGGCTGCGGGATCTTGCTCACGGGCTGCGAGTAATTCTGCTCGAGCCGAGGCGGTAACGACAGCGGTGCTGCGGGCACCTCGCTCGTGT
CCTGATTGCTTGGGTGGCTGTTCTCCTGCAGTTCCTCCTCGTGTTCGtcctgctcttgctgcccctgctcctgctcctgctgttTCTCCTGCTCTACGTC
CTTTGGCTGCGGCTCGGACTCGCTATCGGCAGGCTGGTCCCGGATGAGCCGCACGGTCTTGGTCGGCAGGATGATTGGCGTCTCCTCGACCACTGCCAGG
GCGTCGTAGTACGTCACCAGTCCGTTCACGTTGCCGCGTCCTGGGGACTCAAGTGGGTGGATGGACGCGTCCGCACCGGTGGACGCGGCCATGCCCTCGA
ACATCTCCACGATGCTGCGCACTGTCATGCTGCTTGCAATCGCCACTACAGTGTATTAGCTGGGCTTGCGAACTCTAAATGGCGATCGACGTCGAGAAAA
CTGCGCTTGAAGAACTTCCGACGCGGCTCGCGACGAGGCGACGAGGGATCCCCGTGCTACGCTGGGCGAGTCGGTGGCTGGAATGGCGCGCTTTTTGGGT
TGGTCTctgctgcgctcgaagatCTTGGATTGGCCAGAAAGCGGCACAGTGGGACCATAGAGCCGGAGTAGTTAGGGGTGGACCAAAATGAGTCTGGAAG
GCATaagacgccgaagacgagCGCTGAAGGCCAGCCTGAGGCTCACAGCAATTTATAGCTCGGGGCGAGCAGCCTGCCGCCAGCAGTCGGCGAGGCCTTC
AGTCAAATCAACTTGTCGAGCTGACGAGGCGGGGCCCcatctgcagcaactggtTGTACAACCGGACGACAACGGCATCTCTACACCAATGGTACATTAT
CTAGTGTTGTATACACACAATTACTATTGTTTCTCCATTTCATTGTCGACAAGGCTCAGAAACTGATCCCGCGCGACGTATCCTCCCTTCCTTCATagcg
atggagctggaggtgggcGCCCGCGTGGCGTTCGGCGCCGGCAAGACGGGCACCGTGCGCTTCATCGGCGAGACGGACTTCGCCAGCGGCGAGTGGGtgg
gcgtcgagctggagcggccCGAGGGCAAGAACAGCGGCGAGCTCAACGGCCGCGTCTACTTCACGTGCGCGCCCAACCACGGGCT