Description :
From Genome Similarity Track
Location :
scaffold_353:6567- 8952
Transcript NameFunction/comments
Pl_105729hypothetical protein PHYSODRAFT_360673
Pl_105730hypothetical protein PHYSODRAFT_469461

Sequence
2385 bases(100 bases per row)
GACGAGTCGATTATTGTTCAAGAGCAGCACTTGTAACTTCACGAGAAGCCCTACGCCGACTTGCCATTCTCGTGTTTCTCTAAGTAGTTTCAGATCTCCT
TCTACGTATGGGAGTTCCTTCAGTCGATTGTGTGAGAGGTCTAAATAGCGAATCTCTCGGAGCTTCCACAATTTGGGAGAAAATGTTTGGATAAGATTAT
ATGAGGCTCGAATCGCTGTGAGAGTTGTCGTCGTTTGCAGACACGATGGAAGTCGCGTTAGCTGATTACGACTCACGTCGAGTTCCTCGAGATGAATCAA
ATCTTGAATCCCAGACGGAATTCGAGCCAAACAATTGTTGGAAAGCACGAGCTTTTTGAGGAACTGCAGATTCCAGATACGAGACGACAGTTTCCACGCA
TCAAGGCCACTCATATCCAGCAATTGAACTTGCTCACCGGCATCCTCAGCAGCGTCAACTATCTGTTGAGCCTTCGAGCGTGGGTATTTACGGCTCAGCT
TCCTTTTGGTCGCTTCGTCCAGGTCAACCTCTCCATCTTCACTTACAATCTGTACCGCTGCAAATTCTTCCTCCTCAACATCTCGTGCAGCGTCCTGCTG
GAACCCTTCAAAGTCATCATCATCTTCTTCCTCCTCTTCTTCTTCTTCTTCGTCACCACCGTCATCAGGGATCTGAAGGGATCCAAAAAGCGCGGGTTTC
GTCCAAGATGAAGTGTTGGTGCTCAAATGGGTATACAAAATCTTCCCAGAGTCCGGGTCCGTGGTGAATTGGTACTGAGCTCTCACTAAACGGCGAGCTC
TCTTGCGATCTTTGGCACCACGAAACATAGACTGCAATCGCACTACGGCGAAGGTAAGGTAGGAAAAGTCGACATCATCTTCTTCAGATTCTTCGGGGAG
TGTCCAAGACGTCTCACCAGTGTAGATGTTGTAATAGTAAATTGTCTGTGAAGTTTCGTCGAAGCTCTGTTGCCACTCATTCTCTGTAGCAGAGTCTCCT
GTTTCAGCAGTAGCTTCACCTGGTAGTGTCCACGACGTATCTCCTGTGCTATTGACACAATAATAATGATGAGCTAGTGCTTTCACATTGGAGATATAGT
GATACGTACGCTCGATTGTAGTAGTAAGCACGGCCAGACGCCTCGTCGTACGCTTCTTCCCACTCAGAGCTCATGGTTCGCAGCTCAACGTTTCATAGAT
CAAAGATTGAGCGTCTCTCTACTCAATACAGCTAAATGCAGCAAATTTGCATGGAAATCACGAGTTTGGTCGAGTAACACCCGTTCCGAGTGACTCGGTC
ATAGCGATTCACAACACGAATGTTGACACGCATCAACGTCGAGGACCGCGAATATCAAAGACTGTGAGTTGGAGCTGCATGCTATTTGTTTCAGATGAGC
ATGTGAAGGCTTGACCATGGAGCACCACATTGTTGCTGTTGTGAGAGTGTGCACGAGGTAGTGCCACTACAGCTTCAGACTCAATAGCTTCGTCGACTGC
AACTGGGAATTTCTGTCGACGCCAGATCATGCGACTGACTTCGAGTTTGTACAGCATTGTAGACGCATCTTCACAAGCAGTGAACGACTCCGTTTCGCCG
TCGGAAGCATACGTGTGACCACCGAAGATCACGAGAGTTTTGTCGGTATAAAAGCACTCGAATAGGAGACGCTCGCTCGGTACGTACGGCTGCGCACTCA
CGAGCGTCGAGAGCTTGGGAGTCGACCACACCAGTGTCGTCAAGTCAAGAATGTGGACATCCAGCGAATGGCTCTTCCTGGTCTTGTTGATTTTCCTCTT
GGGAATACGCCATCCTCCAATTACTGCAAGTTGCTCGTTCTCCAGCGCAACCACTTGCATCCCAAAGCGAGCTGATGGAGGCTTCCCGACTGTGTCCGGT
ACGAACCAGGCTGGCAGTCTCAGTCGCTCGTGTTCCTTCATCAGCAACCGAGCAGCATCACTTACTCTTCGCTCTTCACGACGGTGTTCAGTCGTCTCTC
TGTCTTCGTCTCGAGCGTACTTGCGCACGTGTTCTTCCTCGTCCTCGAGTAGGCGCTTCAAGCGCGAGGTTTGCAGTTGATGCAAGTCGCTGTAAACGAG
GGTGTCAGATTTTCCTCCAAATATGAAAATGCTCGGCTCCTGATGCCACAGTTTCTCTGTATCGAACGCGATGCACCATCCGTGCCAATAGCGCTCGTAT
GGGGTCGCTGAAGTGTCGAGCTGCGTCCAATGCCACAACTCAAGTGAGAGTGCGAAGAAGTCTCGAAACACTTGACCGTTGCGACCTCGACCACCAAAAA
CCAAAATGTGTTGTGGTGCCATGAACAACGCCGAGTGATCGCTTCGCTCTCGAGGTTCTCGCCCGGAACACTCCTTGCGCGTCCA