Description :
From Genome Similarity Track
Location :
Scaffold_121:65660- 66902
Sequence
1242 bases(100 bases per row)
ACACCCAGTGAAACGCACCGGTCGGATGATTCCATCATAGACCCGCCCCAATACGGCGCATGCTGCCCATTGATTCTCGTGCGGAAAAGTGACGAAAGGT
CGGCTCCGGTCAGGATGACATCGCAACGGCGTCGAAACAATCTTTCGCTCCAGGATCTCGAATGCTTCTTTCGCTCTGTGCAAGTTCTGTTCGGAACGTA
CTTGTTCGCCCGTAAGCTCATATAGAACGGCAGCCACCACCGGAAAGTCTTCAATGAACTTATGATAGTAGTTCAGACTTCCGAGAAAATGATTGGACAC
CTTTCAAACTCGGGAAAGATAAGTCCTCCACACCTTTTGCGATCTTCGGCGTTGCGCGTATTCCCTTTGCACTGATCTCATGTGACAGGTATGGAATCAC
CAGTTTTCCGAACTCACTTTTGGGCAAGCTCACTGATATACTCCAATACCGAAGTCTGAACAGGAGAGCATTCAGGTCCTCGCACAACTGATCCCAGGTT
TTGGCACCATGTGCGATGTCATCAAGATATGAACTTCGTCTCAGAACAGGGCCCATCCGAGAAAGTGTCGGGATGTTCAGTTTGAACACCGCTATCCGGT
CAGTCAGGATTGGAACGGACCGTTCAGACTTCTCTCGCTCTGAGACATTTCGTTCTGACGGGTCCAGGCCTAAGTACTCCAGCACATCCTGGTCCACTTT
GACCTCCTCTTCGGCGGGTAGTCACACAAAACCCCGTAAGCAGTTGTTGATCATGGCTTGATAAACCAAACGAGCGTTCTTGAATCCGAACGGCATGCGT
ATCTACTGGAAACGTCCGAATGGCCAGATAAACGCTGAAACCAGCTTCTCCCGTTCAGACATCATAACCACCCAAAAACCACTTGCCACGCCGAGACTCA
TGAACCACATTGCTCGTTTGAACCCGATCAGAAGATCATCGATCAGAGGCAGCGGGTAGTTCGATAGTTCGATGAAACCATTCACGATCCTGTAATCAAT
ACACATTCGGATATCCACACCATCCTCTCCAGGACGATGGCGATTGGAGAAGCCCATGGTGAATTCGAATGTTCTATCAGATCAGTCTCCAGAAGCTTCT
TTAACAATTCGTACACTTTCATCGCCAAGTATGGTGCGATTGAGCGAGGGCGTTGCGCAACCGATTTCGCATCACCTACATCCAGATCACATATCACTTC
TCGAGCTGGCGCCGGAGCAGCGTTTCCACCCCCTAAGAAAAT