Description :
From Genome Similarity Track
Location :
Scaffold_109:65645- 66681
Transcript NameFunction/comments
Aphas_H257_17805ribosomal protein-like

Sequence
1036 bases(100 bases per row)
CCGGTTTCGTATGAATCGAGCACTCTTTATTCGGATCATGGATACCGTGGTTGCTGCGGATACATACTTTGTCCAAAAACCAGACGCATTCGGAAAGTTA
GGTAAGCATGGCATGACATATAAATAGAGCTTAAAGATAATATAGGTCTGTCACTATTACAGAAGTGCACTGCGTCCATTCGTATGCTGGCGTATGGCGT
CTGCGCTGACTCGACCGACGAGTACTGTCGCCTTGGTGAATCAACAGCCATCGAATCCGTGAAGCGCTTTGCAAGAGCTGTCGTCTCAGAGTTCGGCCCC
GTGTACCTGCGCGAGCCGAATGAAGAGGACGTCGAAAAACATCTCGACCTCAACGAAAGTCGTGGGTTCCCTGGGATGTTTGGTTCTATTGATTGCACCC
ACTGGGAGTGGAAAAACTGCCCTGTTGCCTGGCAAGGCCAATATCAAGACCGCTACGGGAAGCGGTCTATGATATTGGAAGCGGTTGCGACGCAAGATCT
GTGGATTTGGCATGCGTTTCTGGGGGCTCCAGGGTCCAACAACGACATTAACATTTTGGACAGTTCGACGCTGATGGTGAATCTGGCTAAACTTGCAACT
TCCAGTGATGGATTTTCGGTAAGTACATTTTAGCTCTATATTTTTGGTTGCTTTACGCGTACAAATAAATAAATATTTTGTCTCTAATATTTACAAATAG
ATACATATTTTGTCTCTAATATTTTGTCTTGCATTAATCGTACAATTTTGTGTATTACGTTAATGGGATTTTGTTCGACATGTTTATCCTCTTGGCCGAT
GGAATTTATCCATCACACTCGACGTTTCAGAAAAGTCTGAGCAGTCCTTCAACGGAGAAGGAAGAGTACTATTGTGAACGACATGAAAGTGTTCGAAAGG
ATGGCGAACGTTGTTTTGGGGTCTTGTTTGGACGGTTTCACATTCTGGCCAATCCCAGCCAATTGTGGAGTCGTGACCACATGCGCGTCGTGTGGCTTGC
TTGCATTTGCTTGTACAACATGATCATCGAGGACGA