Description :
From Genome Similarity Track
Location :
Scaffold_53:6564- 9599
Transcript NameFunction/comments
Phyke_g3471hypothetical protein PHYSODRAFT_315622

Sequence
3035 bases(100 bases per row)
GCAGCCACTACCGCCTTTGCAGCTGAGCCAGCATCTTTGAGGAGCCTTTTATTCCGGAAAGCCAAGCGCTTCACAAACTCTGTCTGAGAACTTTTTGGCA
CCAATGTGTGTATTGCTCCACGAGCGCGTTGCCGGGCCACATGCACAATTGACTTAATAAGCGTAGGGTGGGAGGAGGGCGGCATGAACGGTGGCACGGC
AACATTTATCCGCTCCTCTGCCAAGCGAAGGGCTTCTTGCAAcgctgcaacagctgcagaTTTTACTTCCTGGCGGGTCTTCGACGTTATCAACATGTGG
AATGAAGCGCGTGCGGCAGTGTCGACATTGGTATCTTGAGTTGGCCCCACAGTGCTTCGTCCGGCAGAAGTGAGCCCACTTTCCATAGCACAACGATCCA
CTAGAGCATCAACGCGGGGAGTAACAACATGTGTCACCACGTGCTCGCATACATCCGTTGTCACGGTTCCGACCACaaactccaccacagccttcaGCTT
TGGATGTACTTTGAAAACTGCCTCGGATAACGTATCGCTTTCATCATGTACTGACGCAGCAAAGCCCGTTTCGGGCAATCTCCTCTTGTTGTGGTCATCC
TCTATCACAACCTGCAATGGTCGAAGCTTGCGAATGGATGTGATCGGCTGATCTGTTGCTGAGCCGATCGAATTCTTGCGCTTAATACGATAAGAAGGTT
GGGCACGAGTCTGAATGAACCCTCGCAGGTCGTCCAGTTCACTCACACAGTTCTGGACGAACACTTGACTGTAGAGAAAAGGTAAatgatcttctccagt
aTCGGTTTCAGGCCCGGTTTCGTTCTCGCTTGTAAGCATCAACCGCACTTGCAGCGACGGGAGGAGATCCCGAGATTGAAAATCGCTGCTGTGCAAGAAA
TCATGACCCAGCTCTAATACGTGGAAAATGCGTTCAATCTGCATAGCTATGTAGAGCCCCGTTTCACCAAGCGAATTCAAACGCGACGAGCGGTACAAGA
GCTGTAGTAACACCATGAGTTGCTTGAAGTAGCTCGTCTTCGAGGAGAGTCGGTCAAGTGACAACATGGAGAGGTAGTCACAGAGCCATGGGATGCACTT
GGAGATAGATGCGTGCAAAATACTATCCCCCAGCAACTTCTTAACATCTAGACTGGAATCGCGAGCAATTTCGAGCGTGGAGATACCCTCACGTTCGACA
GCCTTGAAGGCAGCATTCTGTGCAGATAACCGACGGATTGAAGACGTGACTTGCCACTGTGGTGAAAAGCGGAGGTAGCCGAGAAACTTTGCCACAACTT
TGAGTCTCAAAACCACTTCTGTGAAGTCTTTTCGTGCATCAGCAGACGGAGATGTAGTGTCGCGAATGGCGTAAAATTGTCGCTCCAATTGGTGTTTCAC
AAGCTCCGAGAACTCGTAGCTGTCACAGCTATGCAAGAAGTGGAAaaagaagagctggttgTCGGAAAAGAAGCCTCGCATACGGTCGAAAGTAGCTGTG
AAGTTCTTGGTAGCGTCATCCTCGTTGGAGGCAGCTCTTGTATCCTGGCGATTTTTTCGTAGTGAGCTGATGTTTCCTTTGCcatttgctttgctgttgc
tattACTCGAGCTATTCAAGCCGACGTTGTTATGCATATGGGGCTGTGGCGATTTATTGGACGGTTTTTGGCTTGAGAATCGCCGATGTAATTTACGGAG
CCGGTCTGGGTTCTTTACAACCAACTTGTCCTCCATGATCTTCAGCACGAGATCTTTATCGCTTTCGCCAAAGGGGTTGGATCCAACTTGAACCAGTTCA
AGGACAAAGAACTTGGCGAACCACCACCTGTTCTCTGGGGACACTtcagccagcagctcccgGGCAGAAGCAATCGCTGCGGCGGCTACGCCCGCATTTT
CAATACCGACCAGACTATGCTGTTTCTGCTGAAATTGACGCAATAGACTCAAAAACCCGTCGCGAACCTTCTCACGGTTTGAGTACAGGAGCGACTCTGC
AGGTGTGCGGTAATGCAAGCGTGAGTCAGTCTCTTCGCAAAATGGCAGCGCAAAGTCTCGCACAGCACTCGCTTTCATCTCAATAGGAAGCTGGCATCCG
ATACGCGCGCTTTCTGCCACACGCAGCTCCTCGCGCCGCTGGGAAACTCGCCCTAATCGCTCCACCATTGCTGTGCAAATATCGCCTACACCACACAAAC
TTTGCTTCACAAGCCCAAGCAGATCTGAGCCCAGGTGCGCTAGCACTTCTTCGATCTCCTCAAACACAAGCTCGGCAAAGTCAAGGCAGTGGACACGCCA
ACAGAATTCCGACGGCGCTTCACACGAAGGAATTGTGGATTCTGgagtgctgttgctgttgtcaCTTGGGTGGACACCATTGCAAACTGCGCAGTCAACC
CGGTACAGCAAGTTGATGAGATTCTGAATCTCTATACACGTACTTCTTACAAACCGTTCCCTGATCAGAAACCCGTACAGCTTGGCGGCCTGCCGATTAA
CCTGGAAGTCAATTGAAGAGGGTCTAGGCTGATCTTCCAGTTGGTTGTCGGCATCATCAGTCTTTTTGCTCATCGTCGGGGCATTTAGGAGCTCCTGGTT
TGGTGGCGCGCATACTTTGCTTTTCTGTTGGACAACTGGTTGCTTCACgcgttttttcttctccacaaGCATCGGAGAAGGTTGCAACACATCTTTactc
gtcttcttcttggtagCGATTCGCAGCACTACCGGCTCAGCCTTCACTCCTACAGACGAGGTTGTTACACTTATCATCTGATTGCCGCCCCATACTGTCG
TCTTTGGCGTCAGCTTGGGCCCCCAAGCTTGCGGAGAAGCTAGaacaggagctggtgcagaagtTGTTGTACCCATTCGTCGCTCCAGTAGCGACCGCTT
GGTCCACGCTGGGGGTCTCGTATTCTCTGATGCTCCCAGCGGTGGGAAAGCTATTGCAGCAGGCACTGGGCGCGCCACAACCGTCGCGTCCTTGGATGTC
AACAACGTCGTCGTAATTCTCCTCTTCGTTGGCTT