Description :
From Genome Similarity Track
Location :
Scaffold_14:656390- 659048
Sequence
2658 bases(100 bases per row)
CCATCGAACTCGTCGCGAGAGCTCCAGTTAAGAACTCGATGAAGCAGGTCAGCGACGTTATGTGGCGAGATATTAACAGCCTCAGCGATTTGCCAGACAA
GTCGTATAGCTACGTAAGTTCATTTGCAGAATATTTTGCAGATAATTTACTGACACGTTTGCATTCTTTAGATGAATGAACGAGGAGCCCACGCTGGTCG
GAAAAATAACTGGGATTCAATAAATTATTGGGTTTTGCAATACAAATTTGAATTAATTGTAGTCGACCTTGACAGTACAATATGGTATTAGACCAATTAT
GGACAATTAATATGGCAAAAGGTTCATTTGGCATCACCAATCAGATCCGATGACATCATCTTCGCTGCCACCTAAACGCCAACATGAAACGGTGGCTATG
ATAGTGTCTGGCAAGCTACGATACGCGAGTCACAACTCAAACTTATCTTCAATTTTGAGCTACGATGGTCCTAAACAAGCAAATCACTGCCTACTTCTAC
ACGTCACTTGACCAAGGCCTATTTCGCTGCAATATATGCGGCAACGAGCGAAAACAAGCTAGATGGACAGGCTACTCTAATCTCAAGTCGCATCTGGACG
CGAAGCATGCAGGGTACTACATTTCGTTCGAGAGCAGTTTGGGTCGCTCATTGCTATCGTTCGGCTTCGTATTCGAAGAAGCTAGTCATCTGTTCCAGTG
GATTCAGTTGATTATCATAAGGAACATGTCCATCCACGAGGTTGAAGCCGTTCTAACACGAGCCATGAGCATGCTACGGCGGGTTGCTGTGAAGGTTGTG
AAGAACTGTCTCGAAGGACTGGTAATTAAAGCACAAGCTTGAGAAAAAATTGGGAGCGCACTGCAGCCCAATGTTTGATGGATAGTCACACGCTCGAGTG
CACTATGGCGCGCTTTTTTTCTGTTTACGTAGCAGATGACAAGCTTGGCGTGCCTTGCCTGGGCCTTTCTCCCCGGGCAGATCAATCTCAGACAGCAGAT
GCACAGGCTCAACTGTTTGAAAGCATCCTCAACGTTTCTGGGTGGGCTTCCTGGTGGGCAACAGCTGTAATACCAAACAATCAGTTGCGAGCGAATTGGG
CGTTCCACTTGTTGGGTGAGCAAGCTACCGACTCAACCTCGCTGTGAGCAAGTACCTGGCCGAGCATGAGTCGTTGCTCTCCGAAGTGAACGACCTTATG
GTCGAGCTACGTCACGAAAACAACTACGCTGGGCTTAAGATGCACACAAACGCCTTCCTGTAAAGCGGAACGTGACTCGCAGGTCGTCTACGTTTACAAG
GGTACAACAGTATATCCGAATCCGTAGTGAGATCAAAAAGGTGGAAGATGTTGAAGTGCTTATCCCGACTGGTGCGAAGCACCGGGAAATTCTTGACCTC
TTCGAGCATATGAAGAGTTTTGAAATCATCTGTCTACGATTACAGCGAGATGAAACGGACATGGCCGAGGTGCGAGTGATGTTTGACGCACTTGTGGCTG
ACTATCCTGCTACGGATGAACATCTTAAGATCACAGCAAAAATTGTGCACCAGGCGGGTTTGGAGCCTGTAATTGTGAAGGTTATCAATGGATATTTACT
GTCTTGAGCGGAGGCTTTACAATACCCATACTCGGTCAGCACTATCGTTCGTGTCAGCCTTCGACGTACCTTTCGTGGCAGCACAAGGTACAGAGTCTGA
ATTTCAATCACTGTCAGCATATGTACGGTCTTACACGCTCGTTCACTGCTTCGAAACTGTATTTGCTCTTGATTCACATCATTGCCATTGTCGCTTGGAG
CACGACAGTTTGCTGCTCACAGACAACCCCACATGTCAATACAACAGCTAAACTACGCACGGAAAGGAGTATTACCTTCAAGACGCGGAGAAGAAACAAT
TTAGAAAATAAAGACGTCTCGCGGCGCCGCTTGTCCTCCAACTACTGTAGCTGTTTTCTCGTCTGCTTTTTCTTCTTAGCAGGCTTGGATTTGATGATTT
CCCCTTACCTCGCGCCTTTGCCTTCCTCTCCATTCCAGAAAAGGGTACCTCGGTCTCGTGCGAGGTCGCACATAAAGCAGGAGCCTTGGCGTGTTTCGTT
TTGGCTTTCACCTCTGGTGGCTGTTCGTCAGTGGTAGTAGACGGTGGGGTGTTTGGAGGAGCAGGTCGCTTTCGTTCTACAATTCACAGAAACGTTAAAT
ACGACACCTCGACCTTCAAACATCAAAGCGTTGTTACCATTAATGGCCAATCACTATAGAGATAGAGTGATGTATATACGCATATCCAGCAGCTCACCCA
TCGTCGAGACCTTGAGCACGGGCATGTGTCCATTTTTCCGAGCGTAGAAGCTTCCACACCTGCTTGTATACCATCTCGCTTTGAGGCTGTATGGTGGCTA
AGGCCAGTTGAATTTTGTTTTAAAATTTTGAAGTATATGTCCCGCACGATAGCACGACCTGCTCATTATCGTCCAATAAGATTTCGTATATGATAATATA
TTCAACCGACCATCGTAGTGATTATGTACAGGTTGGGACGGGACCAATAATTTGCGCATTTGAACCATAGTAAAATCAAGTTCTGTTATGCCTTCCGGGA
CAGTATAGTGTGTGACAAACGTGTCTGCCGATGGGGACTAAGGAGCTGGAGAAGAGAG