Description :
From Genome Similarity Track
Location :
contig_32:656322- 657705
Transcript NameFunction/comments
g6300.t1hypothetical protein PHYSODRAFT_555469

Sequence
1383 bases(100 bases per row)
GCTGGACGGCGCTACCCCACACGTTTTTTCTATTGCAGAAGGAGCTTATCGGTCGCTGAGGCGACGACTGCACGAGCCTGGAGAGAGCAAGAAGAACCAG
ACGATCCTCGTGAGCGGCGAGAGCGGCGCCGGCAAGACAGAGACCACCAAGTTTATCATGAATTATTTAGCAGAGAGCAGTCGGGACTCAGCAGCGACCA
GCAGTAATAAGAGGAAGCGGGCGATCAGTGGCAGTGAGTTGATGAGCGCGAACCCGATTCTAGAATGTTTCGGCAATGCACGGACGCTGAGGAACGACAA
CAGTAGTCGATTTGGAAAGTTTGTACGCATGTTCTTTGATGGACACGAGTTGGATGCGTCCCTGAGGATGGTGGGCACGTCCGTGGAGACGTACCTTTTG
GAAAAGGTGCGCGTGGTGCATCAGAATGACGGCGAGCGGAATTTCCACGTGTTTTATGAACTGCTGGCTGGGGCGGATGATGCTATGAAGAGCGAGCTGC
ATCTCGTAAACCTCTCAGCGCAGGAGTTCCAGTACATCAATGGTGGACAATGCTTCCAGGCAAACGACGGCGTGCGTGATGATAAACAGTTCCAGTTGGT
GCTCCAGTCGATGAAAGTGCTGGGGTTCACGGACGTTGAGCGAGGAGCAATCTGGAAAATCTTGAGTGCGCTGCTACATCTTGGAAATGTATTGTTTGTT
TCCTCGAGCGAGGATGAGGGAGAGGACGATAATGGAACGGCGTCAGCACCGTGTCGACTCGCCTCTTCATCACCTTCGTCGCTTACTGTTCAGGAGCATC
TTGATATCGTAGCAAGGCTTTTTGCTGTGGATCAGGAAGAGCTGGTGTCGGCGCTCACGACCCGAAAAATCAGTGTTGGTGGCGAAACTTTCCATTCAAA
TCTGAGCCTCGCGCAGTGTGGAGATGCTCGAGATGCAATGGCTCGCTCATTGTACTCGTTCCTTTTCCAGTTCTTGGTCTCAAAAGTAAATTCAGCCTCG
CCACAAGTCGCACCACCTCAAATCCTGCCAATAAAACAACGAACAGGGATGCAGCACCATGTATTGCAGTTCTGGACATCTTCGGCTTCGAAGAATTTGT
GATCAATCAGTTCGAACAGTTTTGCATTAATTACGCGAACGAAAAGCTGCAGTATCAGTTTATCCAGGATATTCTGCTCACGAACAACAGGCCCATATTG
AAGAGGGGATTAAGTGGAACGCTGTAGACTACGAAGACAACTCATCGTGTCTGGAAATGGTAGAGCAGCGCCCCAGTGGCATTTTCTCGCTCCTGGACGA
GGAATGTGTTGTTCCAAAGGGCAGTGACGTGGGCTTTGCGCGAAAACTCTACCAGCGACTCCAAGAACACAGCAATTTCAGTG