Description :
From Genome Similarity Track
Location :
Scaffold_15:65625- 66650
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G006544Protein of unknown function

Sequence
1025 bases(100 bases per row)
TTGCGTTGAATGGAACAGCAATTCCGTATTGCTGACACGCGTTGAGAAGCACCTCCTTCTTACTGCCTTTCTTCGGTGCTGCGGCAGGGAGCGCCTTGTG
GTACTTGGCGTTGTCCATCACAACCAAGCAATTAGATATGCTTTTGCCCTTCAAACACCAAAGCAAAGCCGCCATCCACTTCACAAAGTAGTCGTGGTAA
AACGTTCCGTGGTAGTCCTTGGTCTGCTTCTGTAAGAGGCTATCCGAGACAGCCTCAAACACAGCACGCACGCTTGCGCTTGAGAGGAAGACTTGAGAGG
AACTTGGCAAAAATGCAACTGAATTGAAATGAGCTTATGGTTCCTGACACTACATATGAAACACCACTAGGGCTCCTATAGATTTTACAACTAAAACCTA
CACATGCAGAAATAAAACCTATGAATCTGATATATAAAACCTTGGGTACACTGAGGTTGAACCCAGGGGATCTGCTGGGAACTTGAACTTGAAGTACCGC
GGAGATTCCCTGCAAAGTGATTGGCGGAAGCCACTCACTTCAGATGGTAGAGACACGTTGGCCTCGTCACCAGTGTGGTTTCCCAAAGTAGGAACCATCA
TTCACATGTCTAGAGTACTGTCGTGCGTAATCACGCCGAATCTCAATGATTGCGAGCGATCAACACTCAACTCAGACACAGATTGCTCTGACATCAGACG
ATGACGTCACCTGTGCATGTGGGATCACTTTTATGTGTTTCACCCAATATCTTCGCACCCACAATGCACTTCCACAAGGTGGCGTGTGACACACACAAAG
AGCCACCTTGCATGTAATGGCAGCCTTAGCCCATTACAGCTTCCCTCCCTCAAAAAGGTCGACAGTCTCAAGCAGCAGGCCCGCTCGCTGATGGGAGCGA
GATTTTCGCTTTCCACGCTTCGGTCTTGGTCAATTATCGCTGCAATAAAGCAAACTCGACGACCCTTGTGCTTCGACTTTACACTGTTGGGATCGGATGT
GTCATAAAGGGAATCGGCGTGGCGC