Description :
From Genome Similarity Track
Location :
contig_32:656135- 657494
Transcript NameFunction/comments
g6300.t1hypothetical protein PHYSODRAFT_555469

Sequence
1359 bases(100 bases per row)
CTGGCGGACGTGGAGAACCTGGACGCTCTCACGCACCTGCACGAACCCGCTTTCGTGGACTATTTGGCGCAGCGCTACGGTGTGGACCAAGTGTACTGCC
GATCAGGCGCGGTGCTCATCGCCGTGAACCCGTTCAAAGAGATCGAGGGTCTCTACAACCTGCAGAAATACCACGATGAGATGCCCGGCTGGACGGCGCT
ACCCCACACGTTTTTTCTATTGCAGAAGGAGCTTATCGGTCGCTGAGGCGACGACTGCACGAGCCTGGAGAGAGCAAGAAGAACCAGACGATCCTCGTGA
GCGGCGAGAGCGGCGCCGGCAAGACAGAGACCACCAAGTTTATCATGAATTATTTAGCAGAGAGCAGTCGGGACTCAGCAGCGACCAGCAGTAATAAGAG
GAAGCGGGCGATCAGTGGCAGTGAGTTGATGAGCGCGAACCCGATTCTAGAATGTTTCGGCAATGCACGGACGCTGAGGAACGACAACAGTAGTCGATTT
GGAAAGTTTGTACGCATGTTCTTTGATGGACACGAGTTGGATGCGTCCCTGAGGATGGTGGGCACGTCCGTGGAGACGTACCTTTTGGAAAAGGTGCGCG
TGGTGCATCAGAATGACGGCGAGCGGAATTTCCACGTGTTTTATGAACTGCTGGCTGGGGCGGATGATGCTATGAAGAGCGAGCTGCATCTCGTAAACCT
CTCAGCGCAGGAGTTCCAGTACATCAATGGTGGACAATGCTTCCAGGCAAACGACGGCGTGCGTGATGATAAACAGTTCCAGTTGGTGCTCCAGTCGATG
AAAGTGCTGGGGTTCACGGACGTTGAGCGAGGAGCAATCTGGAAAATCTTGAGTGCGCTGCTACATCTTGGAAATGTATTGTTTGTTTCCTCGAGCGAGG
ATGAGGGAGAGGACGATAATGGAACGGCGTCAGCACCGTGTCGACTCGCCTCTTCATCACCTTCGTCGCTTACTGTTCAGGAGCATCTTGATATCGTAGC
AAGGCTTTTTGCTGTGGATCAGGAAGAGCTGGTGTCGGCGCTCACGACCCGAAAAATCAGTGTTGGTGGCGAAACTTTCCATTCAAATCTGAGCCTCGCG
CAGTGTGGAGATGCTCGAGATGCAATGGCTCGCTCATTGTACTCGTTCCTTTTCCAGTTCTTGGTCTCAAAAGTAAATTCAGCCTCGCCACAAGTCGCAC
CACCTCAAATCCTGCCAATAAAACAACGAACAGGGATGCAGCACCATGTATTGCAGTTCTGGACATCTTCGGCTTCGAAGAATTTGTGATCAATCAGTTC
GAACAGTTTTGCATTAATTACGCGAACGAAAAGCTGCAGTATCAGTTTATCCAGGATAT