Description :
From Genome Similarity Track
Location :
Scaffold_1147:6561- 7853
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1147-fgenesh-gene-0.0Conserved gene of unknown function

Sequence
1292 bases(100 bases per row)
ATGAAAGAGAGCGGCTTGAGCTAGACAGGCTCCTTTATGCTCTAAACTGAATAGAGCGCACTGAGTGCTAAACCACGAATGCAGGAAGGCCTACGTAGCA
GGGGTTATTTCTACAATACGCCGCCAGCGAAATCGTACGAGTTAATTGCTGCTGGGCAATGAATGACGGCCTCCAAACCATTGACAGGGGAAACAAGTAA
AGGATCCAATATTGAACAGCTACATGCCCTTTCTTTGCACAATGTAGCCATTTTGAATATGCAAGTCAAACTAATTGCACTATGATTCACATGATGGTTT
GTCATGAATAAAATGCATCCAGACGCATATACACGACGACCAACGATACTCCATTCAGATAGTAGATGGGACCTCGCCCAGGCTGAGTATTTTCCCCTGT
TCAGAAAGATGGGCCTCGGATTACGAGCGGCCCTTTCTCGACGAGGTTAACGGCGGGTTCATAGGTGACCTCCACACGTTCTCCACAGTCTGGACGGCAA
ATCTGCTCAGCACAACTCCAACGTCGTACTTACGCGGACTGCTTTATGCCGAGGCATTAGCTTTGGTAACGAGGCGAAGTTCAATGGCGGCACTGGTATC
AGATCAACCCAACGAACGTTGCTAGTAGAACTCAAGCTTTACCATTTGCACACACAGAGAAACATTTTCCTTTACACACAACTCACTTATCCTGCCTGCT
GCAGCATACTCTGTAGATTCGTCGAGATGGACCAAAACAGCACCGAGCAAGTAGGCGATCGTGAGTCCGCCCAGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCTGCCTTTTGCCGCGGCAGCCACGACAGGAATGCCAGCGACGCTAGCTTCAGCGCGTACCAGAGCCACATGGCGACGAC
GACGTCGCGCCGCACCTCGTATATGTTGTTCAGGATGTCGTCGTTGTGCACCTTGAACGGCACATTGAGGTGCGTTGTGAATGTGAGCACCACAGGAGTG
CTTAGGTTTGCGACCGTCGAGAGCAGGCCGTACATTGTGGCNNNNNNNNNNNNCGTTGCCCAGCCCAGCGTGCTCGACGTCAATGTACGACGGCAGGATC
ATACTCACGGCCATCGGAATGTTCTCGACAATCGGCAATCCGAGCCAGAACCACTGGCTGCGCACGGTATCCCAGGTGACCATGTAGGTGCACAGCGAAT
CGCAAATGACGATCGAGAGCGTCGCGATGGTCTGGACCGTGCGCCAATTCCAGTGCAGTCCGTATTTGCCCATGACAGCCAGCATTGCGACC