Description :
From Genome Similarity Track
Location :
Scaffold_1:655859- 683028
Transcript NameFunction/comments
Phyra_72768tetratricopeptide repeat protein, putative
Phyra_72769histone-lysine N-methyltransferase, putative
Phyra_72770conserved unknown protein
Phyra_93331phosphatidylinositol4phosphate5kinase (PiPIPKD2) putative
Phyra_72772ser/thr kinase
Phyra_93333Hypothetical protein
Phyra_72774Hypothetical protein
Phyra_72775ribonucleoprotein associated TUDOR protein
Phyra_93338P-type ATPase (P-ATPase) Superfamily

Sequence
27169 bases(100 bases per row)
GGGCACTTTTCAAAGCAATGGCCGACACGGACGAGCTGATGCAGGAGCTGTGCGGCGTGAGCCTCTCGGCCATCGACAGCTCACAGGAGGAGGCTCAAAA
GCTGATGGAGAAGCGTCTGATTGCAGTGGAGCGCGCGGTGCTGGAGAGCGACGCCACGAGCGTTCACGATGCGCTGGATGCGCTCGAGGACGCCGACGAG
ATGGCGCCAGTGCTCACGATGGCGGAACTCATCTGCCAGGGTAAGTACGCGGACGTCGTGCGGCTGCCGCAAGCGCAGAAGCTCCTGGAAGCGGTGGTCC
GATTGCGCAGCGAAGAGCAGGACAACGAGGACGAGGACACGCACCTCTGTGTCAGCATCGCCACGGCACTGCAGAGCTACTTGCTGGACCAAAGCGACAG
CGTCGAGAGCCGCCTCGTGACTGCGTACGAGATCCTTTTTGTGGGCGTTACCTTCTTCGACATGTACGTGCAAGCCAATTACACGGGTCCGGCGTTCGAG
AAGGAGACGCTCCGTGACGTACTCGGCCAGACGACGCGCCTGCTGACGCTCTCGAACGAAAGCGACAACAAGAAGGCGCATAGTGATGCGCTTGTAGCAC
TGCAGGTGGACGGTGAAAGTCCGTTCTCCATCTGCGAGTACCCGCAGTTCTTGCTCGTCGGCCGCTGCTTGCTGGACTTTGTGGGCAACCACGCGTACAA
CGACTGGTCCGTGGCTGCCAACGAGGTTGTGCACGGCCAGAACGACAACGAAGTATCCGATGATGTCACTGAAGGCCCCGCCAAACGCCAGATTACGGGC
GGTGCGGCTCTCCGTGCGCTTGGAGAGCTGTTCGAGCAGATCAAGTCGGCCGCGTGGTGGAACGCTCGTGCTGCCGTCGCGCACGAGCGACTGCTGCTTG
CTAAGCACCCGTCCAACACACTGTGGTTTGAAGCTCGCCGTGGATACATTCAGACGCTGAACATGACGGAACTGTTTGCATTTGAGAAGGATACTCAGTA
TCTGCTCGCTCGTGCAAATGTGGAGTGGGGCCTTGCACAGCACTACTTCGACAAGAACAAACATGGCAAGGCTACATTTGCGCGTGCTAAGGAGATCTCG
GGCGTGAGTGTGCAGCTCAGCGGGTCTTTGGGTAAGCGTACCAAGTTCCAGCGGAAAAGTGTAGCTCAGATGGTGTTACTCGCGGCGTCGAAGAAGCAAC
CCCAGAGCGAGGACACGGGGGCTTCTGTGTACGCCACAGCTGTGGCTGAAACGACCCACGTGGACTTTGGTGGAAAGCAAGCCACAACTGAAAACGAGGA
TGAAGACAGTAGTGAATCTGCAGCTGCTGCTCCGTCGGCCGACGGATTGACGGCTGACGAAGAGCAGATCCAAAGACTTGTTCAGGAAGGCGAGGCTTCT
TATCGCAATGTGAACCTGGACCAGGTGGACCAGGATAATGTGCTTCTGGAAAGCATTGCGTTCGAAGATCACAAGCTCACAGAGCAGGGCAACTTGCAGA
TCATAGACCAGATTGTGCTGCTGGGACTGTGTTTGGACGTGAAGAACAGCAACGCCAACGACGGTCTCACGCGGGAGGAGATGATGCCCTACGTCACGCG
TGTGCTGGAAAACCCTAACAACTGGATGGTGTACTCCACAGCTCTACTGGAGCGAGCATGGCTCGAATGCGAGAGCTCCAAGCGCCGTGAGCGCGCTGTC
TTGCAGATGCAGGCTCTGGTGGACCAACACACTACGCGGCTCACGATCACTCAAAACACGCTAGAGTCCATTGCGGACTCTGCCCCAGCTCGCGAGCGTA
TGCAGTTTGTGTATTCTCTGGCCTTCCCCCCGCGGTATGCGCTGAAGCGTGACTTGGCCGAGCGCTACTTCAAGCTCGGCGTCCTAGGCAGCGCTGTTGA
AATCTGCGAAGAGCTAGAGATGTGGGATGACGTGGTGAAGTGCTACCAGCTTTTGGATAAGCCTATGCGTGCAGAGAGACTTGTGCGCGAGCGGCTGGAG
ATCGCCCCCACACCATTCATGTGGGTTACGCTCGGAGACCTCACCCAGGAACCAGCGCACTACGAGACGTCGTGGACACTCTCGAAGCAGCGATTTGCTC
GCGCCAAACGATCACTCGGACGCCACTACTTCGAGAATGGAGACCCCGAGGCAGCTATTCCCCATTACGAAGATGCCGTGCGTGTGGGCCCGATGCACAC
TGGTGCATGGTTCACGCTGGGTGCAATGGCGATGCGTGTCCACCGCTGGGCACTTGCGATGCGCGCCTTTACTCGCGTGGTACAGCTCGAGCCTGACAAC
GGCGAGGCCTGGGGCAACCTGGGCTCCATCCACTTAAACAACCAGCGCTTCGCGGAGGCTTTCGCGGTGCTACAAGAGGCGCTCAAGCAGAAGCGTCACA
TGTGGCAGATGTGGGAGAACTACGCACTGTGCGCTATGGAAACCAAGCGGTACGGTGAGGCCATGTATGCCATGCACCAGCTCCTGGACATGCGCACCAA
GCACAAGCGCCCGGTTGACAGTGAGATGCTAGCGTGGCTCGTGGAAGCAATCATTTACCCCGATTCTCTCAAGAAGATGGAGCAGAAGGCCGATGCTGAG
GCTGCTGCATTCGAAAACGCCGCCATTGATGACGAGGACGAAATTGACCGAAGCGACGATGATGACTTGGCGGAGTTGGACGAGACCGCAACAGCCACCG
ACGCGACTCCCCCGCGCTCCGACGAGCACTACAAGAAGCAGCTAGCGATGCTCTTTGGCCGAGTGACGTCCATCGTGACGAACGACGCCAGGGTGTGGCA
GGTGTACGCCCACTTCAACGACGGCGTAGAGGGCCGCGCCGACAAGGCGCGCGACTGCCGCCTGAAGCAGTGCCGCGCCCTGCAAGTTGCCGGCTGGGAG
CGCGAGCAGGAGAAGGTGGAGGCGCTGTGCTTGGCGGCCTCTCGACTGGCCGAGGACTACCTGGCGGAAGGCACCAAGAAGGCGCTGTACTCGTGTCGCC
TGTACATCCGCGGCGTGCTCAAGAAGGCGCAGCTGGACTTTGCTGAGCTCGAGGCAGTGACGACTCTCGCGGCCGCGCTGGACGAGGTCAACGCCAGGGA
AGCACAGCTTTAGACAGGTGATCGTCCTCAACCAGAGGACCACAATGTAGCCATTCTGCATTTTCATCCAATCCTATGGCCGCTTTGTTTAAAAATTGTT
CCCGCCACTTTTGTGAGGCAGTCGCCAATCAACCGCCTCGGTCCCAGCCGTCGATATTATGCCTCCGCAGCAGGCCGGGCGGCGGTTCTCCGTGGCCGCC
AAGAAGCGCAAACTCGAGGCTGGCGACGAGCCCACGAAAATCGTCAAGCGCGGACCTGGTCGACCACCGAAGAAGAAGAAGCCTGTGGCTCAGGAGTCTG
CTCCCGAGCCCGAGACGCAGCCGCAGCTTACGGTGGACCCGGAGACGACGAGCTTCCTGCAGCTGTTGGAGGAGGACAAGCGCCGCCTGCCGCCCCCGCC
ACCTCCACTCCTCAAGCGACGCGGCGCCGGCAAATCACCGCCCGAGAAGCACGTTGTGGACTTCCAATTGCCCTTCAAGGAGGCGGAGATCAAGAGCCTC
GAGGAGCGCCAATGGGTGCGCCGCCCGCCATCGTTCGGAAAGATCAACCGCTGCGTCTACGTGTCCACGACCATGCCCATCGCAGACTTCCCCGTGCACA
AATGCACGTGTTGCGCGGACACGCACAAGTCCATGACCAAGCGCACGACGCTGATGGCGACGGCGAAGGCGAGGAAGGAGCTCGTGGCCAGTGGAGATAG
CAACGAGGATAAACCGGACGAGAAGCAGCATGAGGTGGACACTACTATGTACTGTGGGGAAGGGTGCTACAACCGTATGCTGTTCATTAGCTGCTCGGAC
GATTCGTGCTCGGCCCCCGACTCAAGCTTGTGCAGCAACAGAGCCATTAAGAGGAGGGAACTCAAGTTGGTGAGGGTGGAGTACATTCCCGGACCTGGCT
TCGGACTCGTTGCGAGCGAGAAGATCAGTGCGGGAGAGTTTATCATTGAATACGTCGGAGAGGTCATTGATGACCGCGAGTGCGAGCGGAGGATGATCAA
GTACCGGGACAATGGCGAGGTGGGTTGCTTTACACAGTGTGCTATGTTGCTGTGTACTTACCAGGATTGGACTGTTTGACTAGACCAATTTCTACATGAT
GGAGCTGGAGAAGAACATCGTGATTGACGCCAAGTACCGCAGCAACGAATCTCGCTTCATCAACCACAGCTGCGACCCCAACAGCGTCACGCAAAAATGG
TAAGTTGCTAGTGACTATTCGGTCCCTAACATCAAAGCATCTAATAGTGTTTGTGTGCGCTCGCTACAGGAATGTGGACGGTATGCAGCGCATTGGCATT
TTTTCACGCCGTAACATCGCTCCCGACGAGGAGATCACCATCGACTACAATTTCTCTCACTTCGGCGAGGCCGCTGATTGCAAATGTGGATCCACTGCGT
GCACAGGCAAAATTGGTCTCAAGCGGTCCAAACTCCCATCGTTCAATCCTCGTGTGGGCATTGCAAAGGCGAAAAAGCAGGTGCCTGTGGACGAGCCTCC
ACCAGAGCTCAAGCGTCCCGTGCACTTGACCTCGTTGGCTTTGCTCAAAAGTGCGCAGATGGATGATAGCTGGCTGGAATATTACGGATTTTCAAGGCGT
CGATTGTTCCTTAGCCACCGACCGCGCCGACTGGAGAAAAAGGAGGCACACACAACAGTAAGCACAGTTGAAGCTCGCGGTAACCCACCATCGAGCAGCC
CAGCGTCGGAATGCTCAACTACGACTGAAGAGGATGTATCGCTCACTCCACCACTAGCGACTCAAAGTAACTTCATCGAAAAGAAGCCACGAAAAAGCAA
CTGGTACGAAAAGATCATTGCCGGGGAGCACTTGCCCGAGATGAGGGCGCTGCACAGCTACATCTGCGGCGGTAAATCAGACTGGACAGCAGATTTGTTG
GTCGATTTTACAATTCAGCCCGCGATTCCTTCACCGCCGAAGAAAAGAGGCCCGGGACGCCCGCCAAAGAAGCGCGGTCGTCCTAAAAAGATGGAGCCTG
TACTCGCACATCCAAAGCGTACCCCCCTAGGCACGAAGCTCAATCACAAGCGCCTAGGCCTCTCCCAAGCACGTTCAAGGGGTGTTGATGAGCTTCTGGC
GTTCGCAAATGGCAAGTCGAAGTGGAACAAGCGCATCCCGTCGTCTCGCTCTATCGACGCGGACCGAATTCACCGCCTTATTTATCGCGTAAAGGGCAAG
CAGATCTTCATCAACACTGACCAGGTACCGTTGCTCGCTGCGTGAAAGCGTTATTACTGTTCACTGACTTGTGCTGCTCACCGTCCTGTAGAACGATCTG
AATGAAGATGCTTGCTTTCGCTGTGGCCTGGCGGGCGAGCTCATTTGCTGCGATGGCTGCCCTGCAGCCTTCCATCTCAACTGCACGAACCTCGCCATGG
TGCCTCCGGATGGCATCCCGTGGTTTTGCTCCGAGTGCACGAACCCGAAGCATCTTCAGAAGGCTTCGGAAACGTCCGACACCGCCATCGTCGCCGCTAG
AGGCACAAGAAGTGCCAATCAAACCGACTATGCTGGTCGGCATCTGCGCACACACGCGGCACCGCTTGTTCCAAGCCTCAAGAAGATCTTCCACGTCTCG
GTGCCACATACCAAGCGCCGTTACAAGAAGCGGCATCGCGCCACAGACCGTTCCTACCGCGAGCTGGAGCACATGCCCCTCCCCGTGTGGAACGAGAGCG
ACGAGAGCGAAGCCGAGCAGTAGCTGGTCAGCAAGTCGGACACTCTCACCAATTGCGCGACCCATTCGTCGCACGCACAACACCAAGGGCTCGCGCGTGC
ACACAACCTATCGACTCTGTAGCTTTGTCTCTTACTACTGCACTTAGAAACTGATGAAAACTTAAGATGTATGCTTGTTGAAAAGGATCAGCAGAAGACT
CTATTGGTTGTAGAGCTTAGCCGGCACGGGGCCTTCCACGCGTTCCTTGAGGAACCCTTCGCTGTCTTCTTTCGCTCGCTGCAGATACCACAAAATACAT
CAGTAAATGCAAATATTGATACAAATTTGCATGGAGCGCACCTTTATGGACGATACCAGAGCAGCGTAAGGTCCCGACGACTTGAGCTCTGGCATGGGTT
TGCCGCCGTCCATCTTGCCCGTGTACGAGTGGTTCAGCTTCTCCTCTTCTGCGGGCGGTGCGTACTCGTTGGACGCTTCTGCGGCGCTCGGGAAGCTCTC
GAACGAGTGTACCACCTCGCCGTGGAAGCGGTACGTCGCCTTCATGCCACTCATAATCGAAAAGTGTCCATTTCCCCGTAATAACGACGGTCAGTATAAT
GAGGGTTCATCGATGGGTTTTTAGAGCATATTAGACAAGAACTTGTTTCGACGATGAACGCGCTGCTTGGAGAGCTGCGTATGCTCAAAGTACTGCACCA
GCAGTCAGGCGTGTGCTTGTTCACGCACCAGTGGAAATGGAACCCACAGGCGCATGCGGAGGGCGTGGACGCGCTTGTCATGTCGTTTACGCAGTTCGCG
CGCGAGATCGACGGCGGAGGTGCGGTTTAGACAGCAAATTGCATGTATCTGTGCTCTCTAACTGTTTGTGAAATAGAGGTAGTGCAGGCGCACTTCGACC
CGAGCCGAGCGGACAAGAAAGACCGCTCTGGCAGCAGTCCCATGCCTGTAAGCGAACAATGCCTTTCATAAACGAAGGTTTATTGTTGCTGATTCGACGA
ATATTTTCGGTCGAAAACCTTGCAGGCCTCGTCAGGAGGACTCATCATGATCTCTCTTCAGAATGAGAACGTCCAGGCAGTGCTGTTTCATGACCGCACC
TCTGACGCAGCGTGCGCCGCGCTCAAGGCGTTTTTGCAACGAATTTTGCAGCGGTTCTCAGAAGAATTCGCGCACGAGCTGGCACAATTGCAGCCTCAAT
TGCAAGCGAGCGCGACACCTACCGCCGAAGAGGTTCGTTATGTTCATTTGGCAACGTCCCATTTCTCTGATGAATTTGCCGCGTTTGTGTTATTTGTAGC
GCGAGGCTGTCGAAGCCCCCTTCCGGAGATTCGAAGCAGAGCTCGACAACCAATTGATGCCACAAACTGAAGTAGACATCATTATGCAATGAGGCGGCTC
CATGGCATCATATTCCCACTATATTTTTGAATACATTTTCTAGGCAACACAGCGGGTCACGACGACGAGCACCTCCGGTCGTGTTGTCATTTCCCCACAA
CTTGCACATGATGGCATCGCTACTATCATTCTCCGATTAGAGTAAATAAGATATGTCGTTCTTAAGGCTGCCTAGCTGCTATTCCAACACACTTTTCCTG
TGTCGATCAATGGCAAGAGGTTTGTCTCCAGTCGTGAAACCCCACAACTCGACCTGGACGCATGAAAACTCGGGCGAAGTAGTCAGTGGGGGCGAGTTAA
ATGTTTCGCACGCGCCACTTGTCCCCGCAGATAAATCGCTATCCTGAAGTACCAAACAGCTACAAGGTCAGTTACCTCAATAATCATACGCCGACATCGA
ATACTCACCAGGAACAAGCCAAAGTTACCACCACCGCCCATAATCAGCGATTCATCTGAGCAGAGCATAAAATAGCTGTTCTTACGGCTCCAATGGTACT
TCACAAATCCGCCTGCTGCACTTGTGTTCGCGAAGGAGAACAAAAACGATTCGCCGGTGCCGTAGTAGTGGAACGCGCGATGCCACTCGTCCGACGCAAA
TCCGCCAAACACGTTGCCTTCCGTGTCCTTGACCACCAGCAACGTGGGGCTCTGCTTTTGTGCCAGTATAAGCAGCGTTTCCAACGACGATCCGTTTGCT
TCTACACTATAGATTCGAAACCATCGGCATAATTGACTCGTTATGGGCAACGCATGGTCAATATAGGCGATATGCTCGAGAGTCAAAATGTTTGACGTAT
CCATCAGCTTCGACTTGTAGTCGTCCGGGTTAAAATCGAACGAAGGTTTCTTCTTGGAGTAGCGCAACGGCGGCGACACAAGAGAGGGGTCTGTTGAAAG
TCCAGCAATCCGGAGTGCCTCATCTTCAATCAACCCTCCCTGCTCTTCCTCCTCTTCTTCTTCTTCTTCTTCTACTTCTTCAAGGCGGCGTGTCCTTATC
TCTCCCCATTCCATTCGCATATCGTTTACGGTGACTGGTGCCTTCTTCAGCAACTCGTTCATGATCCCCTCGGTCTCCGTTATCACGCGAGTGAAGGAGG
CTGCCTTTGGATCAAGCTCGCTCCAAAGTTGATCGAACACCTGGAACATAAACATAAACAGCTTGCTGAAGTACATGTCTTCGTCAAACAGTTCCCAAAA
CGGCTCCAGTGACATCGTCACAATGTCAATCTCCGGGTGCTTCGGTGTTACGCTGGGGCATACAACAAAAGAAATGAGCTAAGACAAGAGTTTGAGTACA
CGCATGTAAACAGTGCCTCACGTACAATAATTTCAGAACCTTCACCAAAGATTCACAGATGGACGACGCCACCAGCCCTGCGTCGTAAGACGGCAACTCG
GACGGCAGTGCGCGCATTTTTAACAGAGGTAGAGCGCCTGGGTCGTTCTTTAGCCAGTACAAAATAGCTCGAAGCATCAGCACACCGCCCTTATCGAAGT
TCCCCAAGATGGTTTGCCTATTAAACCCGAAATGTTCCCAGATGATCACACGATCCTGTTCTGTAGTTTCGCTCGTTGTAGGAGAAGATGCACCGCTGCT
GGTGGCACTCCCCACCGGCGTTGCAATTGTCGTTCCCAGCAAGTGTAGCTCCAAATTGACGGCAGTATTTGACTGCAATTCAGTCTGCATCTTGGTCGCT
ATTTCAACCTTCGAGCACTCAGCAACTTGAGCCACGACAGAATTGTCCGGCGCAACTGAGGAATTATTGCCTCCTTCTAAATGCGCGCGGAACAATCGAG
TGATCTCGTTCACCTGCTGTCTATCTGACAAGAAATTCATCTGCGGCTGGAGCTTCATTTGATGAGACACCATTCGCATCGCCTCCTTTTTAGCCTCCAA
GCGCTCCAGTGCGTCTACCACCTGCACACGCACATTATGAAAAATAGTCGCGTAGTGATGGATCATCCGCTCCACTACCTGGGCACCCACTGCTGCATAC
CGTACATCTTGATACTGAGAATGCGTTCGCCCACGCGGGCGATCAAATGGCAAGCCGGCCCCCGTGTCTTTTTTGAAAGCAATTACTGGGGCAAGAATAG
TGGAAGCCGTAGAAATGTCGACACCATTTTGTTCAGTATGCTCCGGTTGTTGTAAGAAATGCATCAGGTTGATCACTCTCTTCAGGACGATTTGGCAATG
AACAGGCAAGTCATTCACCAAGCACGTGATATTGCGCACACTGGCGTCTTCATCCCGCAGTTGCCCAGCTGCAACGAAGGCATCATACTTTTCATCCGTC
AGCAATGAGTCCGGCAGGTTCTTCAAAAAGTCTAACAGCAGTGCTCCTGCACATTGTGGATCCAGATCTGTCGGTACCGAGCCCTCGGTCTCCACAATTT
CTCGAAGGTGGTTCAAGCGAATGCTCAAAACTGTGGTGCGAAACAATCGTGGTGTGTCTGGGTTTTGCCTCAGTATCGCAACACAATCGTTCACAATATT
AGGAAGTGCCAGTAGTGGGTCAATCAGAGCATAACGGCTGTGATATGGATTCTTCGAAACTGAAGCCAGGCTAATACCGAACACGTACTGCCACGGCTTG
ATGCCCTTAAGACGATGTGGGAAAATGGCTGAAGGTAACTGAATAACTTCTTCCTCCTCCTCCTCTGCGATGGTCACAGCCCCTTGAATCTCCACATCTT
TAGCGTCTTCAATCTCGACTAACACTGGTTGGCCCTCTGAGGATGGCAAAAATGACCCAGCTCTGGAAGGTGACACTCCCACTGCCGCAGCAATGTCGGC
ATCAGTGATTGTAGCAACCATTTCACCGCTATTGGTTTCAGTACTAGGCTCTGCTTCCACCGATTCTGATTGCTCCGGCAAGCGGAATGGTTCACCACTG
ACTTCGATAGCAAAGTGCACCTCCCGAAGAGCGATAATCAATTCAAGAAACAAGCCCAGCCCTTCGGAGCAGCGAACCAATGACCACTCCTCGTAGTTAT
CGCGAATCAAGTGCTCACAAGCCATCGAAAAGATCATCTTCAACGCAAGCCGCCAACAGTGAACTGTGAGCAGCTTGCAATACAGCAAACATAACAAAAA
TCACAAGTGCTTACCATAATACTCGACTCAATTGTGTGGTTATTCAGTGCGATCTTCAGCCAGCAACGCGCCTTCCCTGGATCAGTCTATCAAGATCCAC
ACATCCATCGCAATCAGATATCACCAACTCCTAAAAACAATAGCCCCCACACAAACCTCCGATAAGAATGCAGCAGACAGCACACTCTGCACCAACGTCG
GTTCATCGACAATGAGTGTGCTGGCGTACAGCACGTGCCACCAGGACGGCTGCTCCTCGTCACTGCGGGGCTTGAGTCCCAGTACCAAACACTCTTCCAG
AGCCACACCTGCCCACCATCCAATTAGTCAACACTTTCACTCCACCAAAAATGTATCTACAGTAGCGACGTACAGAGCTCTCCGACACAAGGGTCGCGTT
CTGTGAGCTGTTGGCGCTGCTCCCTGGGCAGGGACACAGCCACCAAGTTTTCTTCTTGACCAACACCAGCAACTGGCTGTTGACCTTCTGCATCACTCAA
TTCCACCGCATTTTCCTTGCGTAGCACCGCTAACGTGGCGTTCTTCAACCGCGACTATACGTCACAAAGTATTCTCAGATTCCTCATTTTCCCTTTAACC
AAGAAAAGCCACGCACCAGAGTGTCGTAGCGCTGCTGCACGAAGGCGTCTCCAACGCCGCCCCTGCCCTCGTGGCGAGTGGCCAGCCAATGCGAAATCCT
GCCCAGCATCGATGATCTCCTCGCTTTGCTTGAACAGCGACTGCGTCTTAGCTGAGCTTGAGTTTGGTTAGCCTATAAATACTGTTTTCAGGGCCTGCGA
TTGGCCGAAACGAAATTGAGGAGAACTATTTTTTTTTGCCACCAAAATGGCGCGGGACTTGACGTTGCCGTCGCCGGCTCGGGCGCGCTCTCTGCATACG
GCACTGAACGAGGCGTCGTCCCCACGCGTGCACAAAACGTTGAGCTTCATGAGCAGCGACGATGAAACAGACGAACAGCAGGAGAACGGCGGCCTCGACA
GCAGCAACGAGGAGCGAAATAGTCCAAACGTTTCGGCTTCTGGTGGCACTTTTCGCTATCGCACTCGTCGCATGGAGAGGCTGGACGTGTACGGGGGGAT
GGACCCGCCCTACTGTCGGTTTGTGCTGCGGATGCCCAGTAAGAAGGAATGTCGACGCTCCAGTTCGGCGGAACAGACAACACCAACATCGCACAGAAGT
CTCGCTAGAAGGTTTTGGTTTGCTGCAGTGTTGAGAGCAGGCGATTGGGTGACTGAGTGTGGGGTGTTTGGCTGGTGCAGAGCCAGTCGGTCGGCGTCAC
CGCCCTGTCCGAGTCCGGCAACGTTGCTGAGCAGTGATCTTGGAGCGACGCTGTCCATGCTGAGTCCCGTAACTGCTCGGCTGCGTCATCGGATGAAGAA
GGTTGTGCTGAAGAAGCTGAAAGTGGAGGACTGTCCGGTGGGTGTTTATGAAAAGAGCTGGTGCGAGGTTGGGCAAGTAGTTGATTGAATTCGTTGTTGT
GCAGAATCACTTCGTGACTTCTTTTGAAGACTTGCAGACCATTTGTTGGCTGGGTGCTGGAATTTCGGCGGAGGTGTTCAAGGTATTAAATTCGAGTTCT
GATTCTGCTAAACTTTCGACTAACTGGTGCTGTTGCTGCAACCTACAGGTTAGGGACCCAAGAGGTGGAGGTTTTTTTGCGATCAAAAAGTCGAAGCAAG
AGCTGCGAAGTGATCGAGAACGGTACAGTGCACACAACTGTGAGTCGCAATTGGAGTAGATATCTGACACAACTGAATCTCTGACAGTGACCTCTTGGCG
CAAGAAATCGCCGTTCTAGAAAAGGTGGCAGCCTCACGGCATAACTTCGTCAACATCGTTCGGTATTATCAGGCTTGGCAGGAGAACGGTAGACTTTGCT
GCCCTTTTAAATGATGATATCGTTCGAATGGCTCACTGACATCATTTTTTTGGATTAAGGGTTTTTCTTCCTGCAAATGGAGCTGTGCGAGGGCGGAACG
CTGCAGGACTTCATGACAACGCGACATCGAGAGACACTCCCAGAAAGTTACTTGTGGACCATTCTCAGGGATGTTACAAGTGGGTTGAAGGTCCTCCATG
TGCATGACGTTGTTCACCTGGACATCAAACCGGACAACATATTTATCACGGAAGACGGGCGGTTAAAGATTGGTGACTTCGGTATGGCGGGGAAAGTGGT
GACATCCACCGAAGCGTCGAGCCGGATAGGAGACCTTGAGGGCGATGCCAAGTATATGGCGAAGGAGCTGCTCTCTAGCGCCGATCGACTTCCATCGGCA
GACATCTTTTGTCTTGGTAAGCAGAAGCATAGCAGAACTTCCGAGTGTAGTTTTGTCGACTTACATTGTTGGCTTCTTGATGACGATGCTGCAGGTATCA
CGATGCTCGAAATTGCTACAAGAGAAACGCTACCGGAGGCTGGGAAGCTGTGGCATGATCTCCGAGAGCGAAAGCTTCCATCTCTGTCTCCAGAATATTC
AGAGGAGCTCGGCGACATTATCCGACAGGTACGAATGCGGACGACTCGCGCTTGTTCTCGAATGGCCAAAACGTTAGCTGACCTGTGTGTCCTGTGCTGC
TTCCGAAGATGATGCACCCCGACCCAGCACAGCGACCCACCGCTGCAGCCATCCTGAAAAACCCCTGCATGCAGGCTGCAACAGAGCCTGCTTCTCTCTT
TCGCGACGTACGCTCACTTCATGACAACGTTGAATCGTAGCCCCCCCCCCCCCCCTCCACGACTAACACTTGTGCTTGTATTCGTCCCTTACAGCACGCG
CAAGAGCAGAAGCAGGTGGCACCCGCCAAGGTTCGCAACACGACTCGGTCTGCCAGAATCAGTCTGCTGACTCCGCACAAGACGCGCCTCTCGCTACCGT
CAGCGTTAGACGAGTCCAATTAATAAATGCGTGGGGTGTCCACCAGTGTCCTCTAAAATGCTGACTTCAACGAAGCCTTTTCTACGTACAAACCCCAAAA
TTAACCGGGCCAGAATACCCTACCCCGGACCGACCCCGTTAACCGTCAAATTCGGCTCTGGTGATCGTTTTGGTTGGCGTCGAGGGCTCTACGCTCCGCC
AGCTCCAGCGCAGTGTCCAGTATCTCTTTTCTTACGTGATAACAATAGTACGTTGCTGCTGAAAAATGATAATGCCGTTCGGGATGCAGGGCCCTAACGC
AAAAATGTGTGTGCAACTACAGTGAAGTTCAACTCGACCGTGTCCTCGTCGCGCCGCAAAAGCCGCAAGGCCCACTTCGGCGCCCACTCGACGCAGCGCC
GCGTCATCATGAGTGCGCCTCTGTCCAAGGAGCTGCAGAACAAGTACAATGTAAGTTAGTACACTGGTACTTTCAGCGCTGTAAGTCCATGTCAGACTCT
CTCTTGAAGCTGCACCAGCTTCAGGTTAGAGCTGGCACTTCATGGCATCGCGGGAATCGTAAGTGTCGCCACACTCTCAGACGGACGACAGCTCAGGCCA
GGCCGCTCGTGTGAATATTATCTTATGGTCCTATCTTTTTTGTTGTTGACAATTTCAGGTTCGCAGCATGCCTATCCGCAAGGAGGACGAGGTGATGATC
GTGCGTGGCTCGCAGAAGTCCCGTGAGGGCCGCGTGACTGCCGTGTACCGCAAGAAGTTCGTCATTCACGTCGAGCGTGTGGTGCGCGAGAAGGCCAACG
GCGCCTCGGTGCCCATTGGCGTCGACGCCTCCAAGGTGGTCATCACCAAGCTCAAGCTTGACAAGGACCGCAAGAAAATCCTGGAGCGCAAGAACCGCGC
CGTGAGCGAGACCGAGAAGGGCAAGTTCACGGAGCAGGATGTCGCCATGGCCAACGTCGATTAAGTGTCCGGTCGTTGCCACTTTGTGGCTGCCATCTCG
AGCATTGTTATCGTAGAGAGAAGGAAAGAACCACCAAAGTATGGCAGGTGCCAGTCCTGCTGTGGTGTTAAGCATCATAATTGAGAATTGTGGGGAGAAC
GCTGCTCCTCCCCCGGGGCATTTGCCAAACGCAAACACACGTTCTTGATTTATCCTACTTTTGCTAGCATGCTTGTAGTTTTTTCATCTCTTGTTCGATC
ATTTGCTTGAGTGAGGCGGTTGGTTGGTCCGACACCAGCTCTACCAGCAGATTGATAAAGTCCACTTCGCGCTCGGAGAACTCGCGTAAGGACAATTCCT
GCATCTCTAGTCGACGAAGCAATTTGTTGCATAGCGGCACAGCTTGTGGAAGTGACCTCTTGACTGTTGCGAGCAACTTGTCTTCGCACTCACGCGCGTA
CTGGTCACGACGCCAACCCTCACCTTTAGCAGACGAGGAAGATTGGCCATGTTGGCGTAGCTTGTTCATACGATCTCCGTGCTTCTCAACGAAGCGATCG
AGGATCGATGCTTTCTTTTTCTCCTGTAAAACCACATTTCATAATTATTAGTGCCTATACAACTTTGACGCCAGGGATTTTCACGTACGTTCTCCAGCGA
GGCCAAGTACATCCTCGTGGCGAGAAGCTCTTCGGTCGTGGTCGCTTTCTCGTGCAGGAGCTTCTCATTCTCGTGGTGCAGTTGGTCTGCTTTTTCAAGA
GCCTGGTTCATCTCTGCGCTGATGCGTTGCTTGCTTAGTCGAGCGGCCACCAAGTCTTCTTCCTTATTGTTCAGGTCACTGCAAAAACAATCACCAAGTA
TTGCACATCAGTTTTTATATGGGTGGTCGTAAAGTGCCAGCAAGATGACAGCAACGTACCGTGAAAGTTGATCTACACGTCGCGTTGACGCGCCTGCAAG
ACGACTATGAACTTGATGTTGCCTACCGCGAACCACAGCAAGGTTATTATAGTTAGGATGTGACGTTAGCATCCGTCCTCTTAACTATTCGATGCAGAAA
CGAACCTTTCCCTCCTTCGATGCTCCATCACTTCTCGGTCTAGCGCTAGCTTCTCTTCAACAACCTGCTGATATTTCTTCTTAATGTCATATGAAGAAGG
CCCACTTGATCCAACCACGGCTCTTCCTTCGAAGGTGCTTCCCTGCGTGACATCAGAATCAACAAATGGTGAACGTTCGTACTTGATTCCCATCCCAACG
ATTGAAAGCAAAAAAAAAGCATTACCCGCAGCTCTAGCGCGACGTTCCGAGCTTGTAGTTCCTGAACCTGGACATGAAGATTGCGAAGCTCTTGCTCGTA
TTGCTCAAATACTTGAGGCATCGACGTCCGATTCTCAAGGGCACGAACTTTGCTTCGCAGCCCAACGTTCGCCAGCTTCATGTTTTCTATTTGCACCTCG
AAGATTGCCCGCAGTTCTTCTTGATCGTGAAGTGCCTCAGCTGCACGAGTATCTGCCGCCTCTTTTGCTTGCTGTTGCTCACGAACAATGGAGAGTAGTG
CATCATAGTTTTTGCGGAGCAATGTTGCGTCTGCAGCTTGAATTTTCTGGGCAGTCTTGACGTCCAGACCATCTAGGTTTGGAGGTTCTAGTAAGCAAGG
GGGCGTACCGGCCTTTTTGAAGATTTCCAGCGTTATACTGTCAGGTTTTGGCTGCGTTGAAGAAATCGGTGACGCCAACGAAAATGATGATGAGGGCTCC
ACTGAGTTTCTCTCCTGTCGAGTGCTGTCGACACCTTCACGAGGTAGAAGAGAAGAATAGGCGGCAGGACGATCAGCATTCGCATGATTCATTTGAGCCC
ACATCGATACATTCTCATCTCTTTGGTGCGTTGGTTGCAGTTCATGTCGGGTGATACCGCCAATTGTGGTCCTGCTGTATCCAGTCGGTTCCAAGATTTC
TTCATCAGCTTCGTGGTCAACGATCGGCAGTGACGCATGTGAGCTAGGTGTCGAGCGTTCTGGAGGCAATGAATGAACTGAGCAGTGTGATGCTCGAGGA
CTTGACAGGATTGTTGGTTCAATCTCATTAACTTCATCCAACGACTCGCGAAGACGCTCATATAAATCGGATATTGATGATCGTGCTTCAGGAGTAGTTT
CGTCAATTTCTGTGCGAGCACCTAGGGCTGGGCACGGTGTTATGTCTGTAGCGGATGGCTCTGATACTCGGGGTACAACAAAAGTAGAAATGCTGTCAAC
GGATCCACCAAGAATGTTTCGTTTCCGCTGTGCGAACGCACTCAACCAGCTCATAGCAGCCGACTCAGTACCCGCGGTGGAAATAGGTTCAGCATCGTCA
CCTGTTGGTGCTTGTTCACGTGGAAACTGTTTTTCCAATATGCAAGCTAGGTTTGGCAGTGACGACGTAGCGGTTGACAGCGACCCGATTGGTGTTGAAA
ATACCGTACGATTCAGCAAAGGAGACTCAACGTCCCCTTCAGCTTCGGGTGATGCCACTTGCCTACACGGCTCATTTTGGCTTGAAAATTCTAGCCGCTC
GAACTCGTTTGGAGTGGACTGAAACCCCAATTGTTCAAACGAAACACCACGAAGTCGTTTACAAACACACGCGAACCCCCGAAGATTAGCCACAGCATTC
AGCATCTGCACGCTTTCTCGTAAACTCGTGCGCGAATCAATCACATTTGCGTAAACGAAGGTTTTGGCGTTCGCAGTCAGCAACGGCAGCATGAAGTTTG
ATAATACCATTTTCCCTGCTGAGTTGATTGGACTAGCGCGATCAGAAACAGAGAATCGGCTATTGCTTTGTCTCGGAGAGAGTACTGGTCGCTTCAAGTC
TTGCAGAATATTGTAAAACTCGATCTTCTCTTGTATCAGAACGTGATCCTGGAAATCTTTCTGATCGATGAGGTCAACGAGGTGCACCGTGCTGACTTGG
CCATCGAAAAACAACGCCAGGCGCACGAAGAAATGGACACTTTCTACGTTTTGCTTGCGAACGATACGGTTGGTCTTTGCAGTCTGCACAATGCGAAAAG
CTGTTGCCAAAGATGAAGCCTCCATGGTAACAAAGGAGACTGGTTGATCGGTTTGAACCGAAGACATTGGGTGTGCTCTTGCACCGACTGGTGCTCCTCC
TGCTGGAGTCTTCAAAAGATCGATTGCCTGATTGTTCACTATGATCCAACTACTGATTCCCAGTCGCCAGGGATCACTTTCTGGGTGCTGCAGCCGTCGA
GAATTTCCATATCCCAGATCCAATTGCGAGTAAAAGGCATGAAGCATTCCAACGAGCTGGCCATACAGCTCCACGACGTCGTTTACCGCCATCTCTGGTT
GGGGAGCAAACCCTCCTCCGCCGACACTTTTACCAAACAGCAACCGAAACTTCTGTGTAGGATGCACGCCCCACACGACAACATTGGAGTTGATTCCCTC
CCGCGCAGTACGAAGAGCAGGTAGTGTGATCTCAGTGAAAAAGTCGATGGCGTGAGAAGGCGAGCTTGAAGAAAACACCGAGTGAAAGTCCCATTCGGCC
GAAGGATTAACACCACTGATGTTAGCTCCAGTTGGTAGCACCCCAGCAATTCCCCCATTTCCTGCTGAGGATCCCGAAGATGTATCACCAGCAGGCTTAT
TCGCCACACGCACGGAGTTTCGTTGGGATAGAACTTCAAATACTGGGGTGGCCCGATTCGCAGCCGTGACATAGCACGAAACGTGGATATGGCTCAGCAC
CGAAACACCACCATCGTTTGCGGGAGGTGAGCTTCCATCGTGATGACTTTCGCTGCCCCAGAAATCGTCACTTGTGCTCCTTACACTGCTGCCTCGGTCG
GCCATTGCGTCAAGAAGCAAATGCCCGTTTACCTCCCACAAGGACGCATTTAGACAACGCTTGCCGTTCTGAAGCCAAAACGCCCCCGCAAAAACATCAC
TTGCACGACGACGCAAACAACGATGAAACGCGATTCATAAAATAAAAAATATAACGCACCCACTGCTGTTGTGCTGAATGCCGAGCGCCGCGAGCTGCGC
TCCAATAATGACTTCTTCTGCTCCTCGATCTCGTCTTCCCTATCGCTCCTACCAATATGCTAACTACCAATACACCAGAGCCCCTCCATGTCTCTGGTTA
CTCTAGATTACATTAAACTTTGCTTGATTTGTGTTGTATCCGCTGCCACCATAGTGCGGAGGTGATGGTGGTGTCTTGGTTTGAGAAGGCAAACATCTTT
TCGGATGGTTGCTAATCACGGCTGCAGCTCGCACGTGGCCAGGTGCTTAGCTGCATCTTCAAAAGTTGGGGCTTCGTATGCCGGATGCAAGAGGGATAGC
GCGTGAGAGCTACCATCCTTGAATGACATCTCGGAGGACTCGTCGTTGATTTCCTCCATGATGCTGTCCTCCAGAATTTCAGATCGTTCAAGTGCCACGT
GCGTGTCTGTCTTTTGTCCAACAGTCTCAACGAGCTCGTCGAATAAGCCAATCTTCCACGCAAGGTGTTTCTCCTCCAAGAAGTGCCACACACGGTACGC
GTTCCAGAAGTGCGCGTTGTCCAGTTTCTTTACAAGGGCACCGTTCACTGTGTCACGGAACACCTTTTGAATTCGCTGCACATCAACGTCAACATCGCTC
AGGTCTACGCCGTTGTTCACGAGGAAACGCAGCAGCACTAGCAGCTCGTATTCGGACGGCCGGTAATGACCGCTATGGGGATAAATAGTTTTAATGATCC
CGTCCATGATCACCATCATACCTGCCGTCTGCACACACTCGCCGCCAACAAAACTCGTATGGTGGATTCGGGGAATCTTCTTCGTCTCTTTTTGAGAGCC
GTAGAGCACTCCATCACGCAGCACAAAAATCCACCCATCCGGTCCTGTTTCCACGATCTCTTGCGAAACGTCATGTACAATCTCGCCATTTTGCACCGAC
AGCGCAAATTTCTGCCGCTCTGCAGCCGTATCACAGTACAGCACAGTCTCGCGCTCAAGCTTCGTTCTTGGTACGCCTGCAACTTCGATCGATTCGTCGT
CCAGCCACTCCCAGAAGCTCGGCTTCGTGGGCTCCATGGGCTGACGCTTCCACTCTTTATAGTACGCCCTCAGATTGGCGCCATACCTGTCCGACAAAAG
AAAACAAGTAGTCACACAGCGTGAGTGCAACTGTCGAACATTGCAGGATCCTGAAGAGACACAACGGACGCACCGGTGTTTGCGGTCGCACACTTCCAAC
CAGCTCTTCTTGTCGACGACTGAAATGTTTCCTGCACTGTAGCCCTTTACCAGTTTGGGCGAGTACTTCTTGGCCAGTTTAACGATCTCGTGCATGTTTT
GGTAAGTCGTTCGTCGCTTGGCACGCATGCCCTCCGCGGTCATTTGCTCGGTCGTTCCTGCTTTGGCTGCTGAGGGTTTTGCCTATCTTTGCTCTGCTTT
GTATTAGCCGACTCCCGTGACTTGCTCCGACTCGCACTCTTGGGCCTCTGTTGTCGTCGCCACGGTGCCGTCTTTCAGTAGTTCGTGTGGAAGCTACCTA
CTAAACAAGAGCGTTCTGTAGCGTGCAAGCCAAGTCAAAGCCGCGCGTCTTCCTCCGTCCAGCTAACTGCGAAAGCGCAAGCGCAACGGCAGCACGTGGC
ACACACAGAAAGGGTACAGAAGACAGGCACAAACACCCGCCGTGCTTTTGGTGTGGACGAGGGACGGTGGGGACAAACAAAAGGAGCTCGTGCACAAACG
TCTTTTTAGAGGCGCGTGCGGCAACTTGTTTTGAGTGAGGGTGGGTGTTGGGTGTACGAGGAAGAGCTGCTCTCTACCTCCACCTTTTAATGCGATAAAT
GCACTACTGCACACAACAGCGCAAGACAGCAGAGCACATACACACGTTAGTCGTTAATACTCGCGTCGGGCGACGGGAAGCGACCTCAGCAACCGCAGCT
CTCAAGTGTTCTGATCCGTACCTGCTTCTCTCTGCGCAACGTTCTTCTGTCTTCTACAGCGCAAATTCTCTAATGAGGGCAACCGACACGGCAATTTCAT
TGCCGCACGGAGCCGGCTATGTGTGCGTGGGTCTACTCTCTGACCACCGCGGCGGTTCGGGGCCAATCAAATCCATCGAGATCTCTTTTTGGCCAACCAG
CGCGCGCGGGGTAGGGCCATCTTTTGTGGCCCTAACCGGTCCGCGGTTACGAACCGTATTACCGAGAATGTTCGCTGAGCAAAGTGCTTGCCCGACGGCG
AGGCAAAGGCGACACCTGGCTGCGCTCCCCAGTGAAAAAATGGCGCGGCTCGCCGGCGCCGATGGGACGTGCCCAAGATTCGTCTCAAAATTGATTATCG
GCGAGATTCGGTCGCTTGCAACTGGACGACCACCTTCCGCCCCCGGCAACGGCGACGCCGCGGCGTGGCGTGGCGTAGCATGGCATGGCCGCAGTGTGCA
TGTAGTTGCAGTTGGCGCAGGCCGCCGCACGGTGTATCAACAATAAGACGAGGATAAGACCTCGGTCTGCTGCAATGCGCGACGTTGTTGCTGCCTTGTC
GTTCGGATACTAAGAGCTTCAGAAGCGGTGAGTTGAGAAGGTCTTGTTGTGATACATGTGCAGATTGCCGCGTAAATCACGCAGTGATGGCACCGCACCA
GGCGCTGCCGAACACATTCATGAGTGCACTGGCTGCACACGCGCTAGGCCGGTCCCACCTGCGCGCCAATCCTATCTCGTGATCGAGCTCGAGCCCAGCC
GGCAAGGTACATGGTACTGACAGTAACTTACTGTACCGTATCCTATCCAGCAGCACAATCGCCGATAGCTCAAGCGAGGCGAGCACCTAACCGAGGCATT
GAAGCCGCGTTATTAATAAGCGGGACGTGGCGAGCGCTGAATGGTGTGACGCGTTCGGCGATATCCAGACAGATGGCTACAGCTGCCGCTTCGTGAGCAA
AAGGCAAGACGCCGCACTACGCTGCGCCGCACTGTTGCTGGCGGTTCCGTAACGGGCAATGGACATGTAAAGCTACCGGAGAAGCCGCAGAATTTTGCCA
GTCGGGCGAAGAGATGCCCAGCGGTAGCAGCAGCGAGTGCAGTACCGAGCTCGAGGCCTCGAGCTCCGCTGTCTCCGCCTCGGCTCCCGACACTGAGGAG
CAGTACGAGGACGACGGCTTTGATGAGTACTCGGACTCGTTCGAGTCGGACAATGATGCTGGCTGCGACGGGGGGTCAGTATCAGCAGCAGTGTCTGTTT
CCAGCAGGACGGAGCTTATCTTGCTGAGTGTCGGGACGCGTGTGCAGGCCTTCTGGCGAGAGGAGAACGAGTGGTTCGATGGCACCATTCTGCATGTTGA
GGAGGGGAACGAGCGGCGTTACTACGTGCACTATGACGACGGTGAGGAGCAGTGGGAGGTATTAGATGTTTACCTGCTGTAAATCTCTCTGCTCCCATTA
CTGAACGTGCAATTGGCGTTTTGCTGTTGGTTTTCGTAGGGTCCATCGAGCATTCGCCCGCTTCCAGCATCCGTCACTAGAACAACCGAGTACGATCAAC
AACAGCAGCTTTTGCCGCTCAGTAAACAAACCGCAGCGGCGATAACAGGACGACGGACGATTGTTTACTGGCCTGACGAAGCTGAATGGTTCAATGGAAC
CGTCAGTGCAGCCCAAGTCTCTCCTCCAGCGCTTAAGATTGAATATGACGACGGTGACAGCCGGTGGGAGCAGGCAAGTAGCACGAGCTCGTTCTTGTCT
CCGTTCAGCGCACTCATGTTTCTCTGTATTTCATAGGAGCACTCTTTCAATTGCATTCTTCTGCAACGAGCCATAATGGACCCACCAGAAGCCCCATTAC
CACCTTCTGCCACTTCTGGACTCATGACTGCGGTTCCACCGCCTCCGCCTGAGCGGGTGTTAAATGCTCGTCCATACCAGCAAGTAATTAGCGACCATTT
TCAACCTGTGCGTATCGCACGGCCATATCGCTGTGCTGTTGAGAAGCACAGCGAGTCTGTAATTATCCCGCGTCGCTTCTCCTCGTTACCAGGGGGGAAA
GCTGACTGCGTCACACAGACAATGATGCCTTCATTCTTCTCTGAATCATCGTGATCTATTCAAGATAAACAAAACAAAACATTTATGCGTTCTTCCTACC
GCGAACCGTTTTGAGCACCTTCTTGATCGAAGCATGTGCTCCGAAAGAAGACTTCGAATGCTCGGTGTCGCCTCTCGAGGACGCTGCCTCCACGTCGCTA
TCCACGTTTTCGTCTTCCGAAAACGCGTAGCCGTGATACTGGCCCCCTGGGACTCCGATAAACGATGACGACCGAATTGCTGCTGTATTCGTTGTGATTG
TGGCGGCAACTGATCCAGGTGTTTCCAGGAAAGATGGTTCCACACCCGAGCCAAAGCTATCACTGCTGCCTGTGGCATGGAATGATCCGCGTATGCGGAT
GTTACGCTTCTTCTCTCGGCTTTGGAATCCAGCCACTTGATCAGGGTTCATGGTGTCCCCGCCACTTGATGACGAGAAAGGAGATGCAATCAACCTCTCG
CCAAGAGGAGAAGAGCGCATAAGCGTTTCCTCCGGACTCTCTAGTCGTGGCATATTGCTGAATAGCTTTGCATAGTCCACGACTGTAGCTGGTGTATCCG
ACCACGCCGTACTGGATAGAGATCGCCGGTGTTCACTCAGCATACCACGAGGTGAATTCGGAAGACCCATCAGCTCCCGCTCCTGGAGAATATGGTACAA
TGACGGTAGCGAAAAACGACGCACAATCTTCCACAGAGCGTCACGCAGCAGGCTCAATGACAGCACCAGGGTACACACAAGCCAGAAAGTTGGGAGCTCT
TGAAGATATTCCATCTCGCCAGTAGCTTGAGGGAAACCAATGTTTGGCAGCGAGATGAAAAAGCCAACGGCAAACCAAAGCAATATTGACACGGTCACCG
TCAGTAGGAACTGCCATGTGAGCATGAACGTCTCGAGGCACAGTTTTAGGTTCACAACGATCACAAGATTCGTGAACACCACAAATCCCAGAGTGACGAG
CCCACCACTTTTTCCTGTCTCGGTGGCGACAACCGGAAAGCCACGTATGCCTAGACCGAAGCCCTCAAACGCCCAGGCAGAAACGAAGAAGATAACAAGT
GAGTGCCACACACCGTTGAATATCCATGGCCAAAACACGCGACGGGCGAGCAAAACGTTCTTTTGACCAAGCGCGTACAAGTATGGGAACTTGGCGGCAC
TGGTGGAAGATACGTCTTGGTCGAACACAGCAAATAGTACCAATGGCACACTCGTGTAGAGCACATTAAAACTCTGCGCAGCTACGTCCAAAATAAGTGG
TTGGCCCGAAAACCCGCAAAAGCATCCAAACCAGAACGTTGTGAGCACATACGTCACGTTCTTGTAGAGCATATAGCTCATGAGTTTCGCCACACGGCGA
TAAGCCCACCGGCCATGTACAAACAGTAGTCGCTGCAAGAAGCGAAATTGTGCCAGTGCATAGTCAGAAGCGTTCACCGCCTGCGCTCCTTCCTGGCCTG
AAATGCCAACACCAATATGCGCCGACTGAATCATCGCCACATCATTCGCTCCATCTCCAATCGCCAGTGTCACGCTGTCGGGCTCAAACTCGCGAACAAA
TTCGACGATCTCAGCCTTCTGCTTTGGAGACACGCGGCAGCAAATAACCGCTGACGCGCACTGTCGAGTGACTTGGTAAAACAGTTTGCGCAGTTGAGGG
CGAAGGGCGAACTCAAGCGCCTGTCCGTCGATTACAAGCGCTAGTTTTTGAGACGTTGATTCACCCTGACGACGCCCCTCGCCACCGTACAAACTTCCTG
TAAGAGACCCATACTCTGGTGTGTATACTGCCTCGTTCTCAGCATCAACCGTGATATCGTACAGTGATTCCTCGTCGGACGTGAATTTATCGGCGTATTC
AGCGTCTGTTGCGACTGATGAATACATTTGCGTTTGTGAAGATGCATTCGACGCACGACGACTGCGATGTCGCCTTCGTTTTTGCTTTCGCTTTGGCTTT
GTTGGAGTCCCAAAGAAGAAGCCGCTTATTGCTGCCTTTGTGCTACCAAGAAAACTGTCCGTTTGAATCGATGGCCGACGTCTGCCATCGCGATAGCGGC
GTCGTGTCCCTCTACCTCCGTTGGTCCTTGATTTAGTGGTAGAAAGTAAAGCCGTGAATGGTGATAGATGAGAAGACAAAGAGTCTTGATCACCGCGCAG
GGATAACTCTTTCAACGCTGCAGCTGTCGAGGTGTAGTCATCACCACCAATTTGCTGCAGATTCATATCGTGAGAAAGCAGCGCGCTGGCATACCCAATA
TTCACAGCAGTCTCCATTTTGTCACCTGTGAGTGTCCAAACCTTTATGTTGGTCTCTTGCAGGAGCCGAAGTGTTGCAGGCACCCCAGCTTGGAGTTTAT
CTTGGACCGCAGTGACCCCAAGTAGGATAAGATCACGTTCAATCTCGTTCATCAGCGGGTCAATCGCATTTGCACGGCCTTGACGTCGTTTTACTAATTC
CTCCATCGAACCATGCGCCTGCGTATAACGGGCACTCCATGTCTCGTACTCAGATCTGCCGATCGTTTTATAAGCGAGGCAGAGCGTGCGCATACCAGCC
TTCGCGTACAGCGTGAGTTGTTCAGCTGCTTGTTCGCTAGACATACCACCAGGCAAAGTCGCTTGATCCGCTGCAAGACGCTCAAAAATGACATTGTCCG
CGCCTTTGCAAAGGAGTTCAATCGCACCATCGGGGGCCTCTACAATTACCGTCATGCGCTTTCGGTCGCTGTCAAATTCCAGCACATTTAGCAGTTTGTA
TGTGTTAGGAGTTGCCCAACCTGGCTCCATGACCATCATGGTAGTGGGTGTTCTGTGCACAAAGCGCACATTACAGAAGGCCGCTGCAGAAACTAGTGCC
TGTTCATCGGGCGATGACGCAGAGTACTCTGGGAAAGACGTACTGCACATTTCAGCAAACGATTTGGTCGGGATCAACGTATGGCAAACTGCCAAGTGCC
GTAAAAATCGACGAAGAGTTTGCGCCTGCTCTCCTCCTGCCTGAATGTCGGCAAACAGCTCGCTTGGGTCGAAGTCAACAAATCGTGGGCCATCATTTAT
GGCAGCCATCGAGGGAGATGAAGGCTCGTTGGCCTCCTCCGCTACCATATCGTTGTCTTGCATCAGACCACCGTAATGTCGTCCTCCAACCATACAGTAA
CGAAAGAGCATAAGATTCATCGTGAGCGTGCCGGTTTTGTCCGTAAAGACATGATGCACGCGGCCTAAATCTTCGTTGAGAGCTGATGATCGCACCATTG
CAGGAGTATCGGATTGCTTGTCGTACATCTCCAGGTCCTGCTCTATAAAGTAGGCTTGCCAATACTTGACGAACTCCAGCGAGACGTTCAAAGAGATGGG
GACAAAGTTTTGCATGATAATGAAGTACCGAAGATGTAGCTTCGCCAGCTCGGCTAGCGGATGAGAAGACGGCGCGTCAGTCAAATTATGATGCTTCCGC
TCAGCAGCACTGAGGAGGTACCAGAAATAATCTCCTTCTGTATGCATCCAATGGGCACCAAGCAGCGCTCCCAAAAAGCAAATAAGTTGCTGGATGAACA
CGATGCCAATGATAAGTCTGTTCAGTCGCCGCTCTACAGACGAAGTCTTCACAACAGGTTCCGTGTTGCTGCAGAACACCTTGGTCTCATGACCTGTAAA
AATCACCATTCCTGTGACAGAGCGCGTATTACGAAGCACGCAGCTCCGCAGCATCATTTGCTTTGCAGTGACTGGCATGCACACGCGCACGAGACCTTCT
CCTGTCGTCTCTGCCTGCAAAACTCCAGCAGCAGGCTGTGAAGGCTGGTTCGTATTTCTTGAATCACATACAGCTACGCCCAATGTGTCTGCTTGAGTGG
GGCTTAGCATAGCCGAAAAAGTGCCTTCGAAGCTGGTAATGCGATTGTTTGGCTGCTCGCACACCATGATGCCACGCAAAGCGTTGTGCCCACCGCCATC
AATGGTGCGATGGTTGCTGCCAGAGTCTCGGCACAGCGCAGCCACCAACGGGATGGCCGTACGGATCTTGAGATTAGTTTCGCCATCTAGTGACTTGGTC
TCGATATACGCCAGATTGGCCTCCACCGTCTCCTGCTGTGGCACCACAATTGCTGGCGACGAAGGAGTATCTCTTCCATCTGAACTAAGACCTGAGGCAT
CCGCTGTAGGGTTCTTCCCCCCTTCCTCCAAATCTTCATGACCCTGCACTTGTCTCGGGTTATCTGTTGTAACGTGATCCTGCTGCTGCTTATCGACATC
CTCTTCGTGCTGCACCGCTTCCGCTGAGAGCAGGAACAAATCCGCCGGAACGGTTTGGTCATTCATCACCTTAACGATGTCTCCCACGCTCAGCTCTCCC
CACTGTCTCTGCTCCCAGCTCCCCAACGGTGTAAGTGTCAACACGGGACGACTATTGGCCACTCGGTCTGCTCGATGCCGCTCTCTGTCCTCCAACGCCT
CCTTAATCGCGCTGCACACAAACACCACCGCCAGCGGCAGCAGAATGGTCGGGATGCCGTTCGTGTTGCTCACTTCGCGGATAGTCTGGAGCACCGCGAT
AAACAGGAAATACACGTTCGAGGGCCGCTGCAGCTGCGCCAGCAGGACGCGCGGAGCGAAATTCCAGGCGCTGTACTTGGCGCTCACCACCACGTTGCTA
GTGAAGGGCGACGGCGGCTCCACGGTGTCCTCGTGTGGGCGCTTGGTGCCGCCGAACAGCCACGACGACCGCCGGCGGTTGCCCAGTCTTCTTGCCTCGC
GCTCCTCGCGGCGGCGCCGGCGCTGCGCCGCATTTGCGCGCGCCAGCAGCGTCTTGCGGTCCACGCGGATCACGCGCAGACGCTGCCCCGGGTCCTCGGC
AGCCGCCGCGGCCTCAGCCTGGATCCGCATCTTGTCCGCGAATTCGCGAATTGTGTTATGCGACACCGA