Description :
From Genome Similarity Track
Location :
Scaffold_106:65576- 69796
Transcript NameFunction/comments
Physo_141963hypothetical protein
Physo_141964hypothetical protein

Sequence
4220 bases(100 bases per row)
TGTCTCTTTGCTGGGTTTGCCTAGATAAGACAGGAGAAAATAGACACACACAAGAGTGGTGGTTTTACAAAGTGTAGGTTAGTTCTCCACTGAAAGAAAA
GATACTCACTCACATCAATCGATCCAAGGCTGTCACGGATTATGACAGTGGCAAAGCGACCGACAGAGGCGCGTCGTACCTTTCTGCTGCTAACACAGCG
GCGGCAACAGCGGGCGATTAGGCAAAAGGGCTCCTTCTTTCGGGTCGAAGGGTTTTACTGGGGTCTTGTTCCCTCGCCCCCTCGCTGTCACTTCGAGGAG
GGGAAGGGAAGGGAAGGGCGCGCTCTGTCGATGAGGGTAACTGCGGAGTTGGCGGCGGACGGTTGGGGCCCAACGCGTGGCGAGTCTCTCGGCGGAGGCG
AAGAGGGGGCGGCGCTGGGGCTGAAGTGGAGCGGTGGTCCGACACTGGGCGCGGCGTTCCTGTGTGTGGGCCGATCTGTCTCCCCCTTCCGCGATCTCCG
GCCGCTCCGGTAAAGTGCGAGAGCAACTGCCGAGCAACCTTGGGCGGTCCTGTCGCAGATTGGCGCCTGCTCGGCGACACAAGCACGCTTACGTTGCGGC
AGTGTTGCCACAGCGAGAAAGTTTCGTGCAACTCAGCCAGCTTCGTCGTTGGACAGCACAAGCTTCAACACGTGTTTTCTCCGCTGCAGCGCTGTCTCCG
GCTAAAATGCAGTCGCCACGCAGCCTCCGCGCTCTATCCGTATAAGCTCCATCGCTCGACCATCCACGCGCCAGTACCCTCTTCACTTGACTTGCGACTG
CCGCATTGCCGTAAGGAGCTTCAGCACTTGAATATAAATCTAGGAAACGTGCGGCCGAAATGTCTTTTTTCGACACTTGTTGCCTGCGTCAAGATGGCAT
TTACAGTACACGTGTTTTTTCGACACTTGTTGCCTGCATCAAGATGGCATTTACAGTACACGTGTAAGGCTGCATGAACTCTGCGTGTAAGTTAGGGAAC
TCGAGCTTATCGTTGGTGTCGGCCATGGTGCCCGATCACGATGTGATGATGGTCCGCCCTGGGTGGTCAGCCGCATTGTGAAGCCATGTCACCGGTTTCT
TTTCTGAAGCAGGGCCGCGGAGTATCATACGCAACGCACTGTGAACAAGGTTTTTTCAAGACGTGATCGATGTTTTGCTAAGTGATCGGCGGCAGCTTTG
GCGTATTGCCGGTGGAAGCCGGCTTGCCCGTCCGAGTGCTGCCAGCTTGGCCTGAAGAACCTTCGCTCGTGCCCGGGTTGCTGCCGCCGCTCGGGTTCGA
GGCGTTGTTGCTAGCACTATTGCTGTTCCCCGCCTTGGCGTTCTGGGTAGACGAACGAAATATTTACGCGATGCGTCGTCAGAGAGCAACAAGCTTACGA
ACACGACCATACCATCGTACAAGTACCTGGTCTTTGTAGTTGGAGACGATGTAGTCCAGGTCGACGATGCGCGAGGCGATGACCTTGAGCAGGCTTTGAA
TGTACTGTGCGACGTCCATGTCCTGCTCACGCAGCACCGGCAGCTTGTCGCCGAGGTTCAACCGACTGTACAGATTGGTAACAGTGAGCACGATCTGGCC
GGACTCGCGGCTCCGGTCGTTCGCTACGCGATCGTTGCGCTGCCTGTCTAGGTCTAGACGTAAAGCTTCAGAGCGCAGCGTCTCAAGCTGCTGCTGCTGT
CCGTGGATGCTGCTATTCTGCACCAACACGAGGTTCTGCATCTCGACTTTCAATGCCCGGATACGCTGTCGCAGTTGGTCCGTCTCGACCTCGGCGGCGC
GCACTTGAGCCTTCAGATCGTTGTTTGTGTCGACGAGTGTTGCATGTCGATTGAGAATATCGCCGATCTCCTCGTACTCGCCGTCGGACGCTTCCACTGC
CGCCTCGAGATACAGTCGATATTTCAGCAGTTGGTCCCGTTTGCGCTCCAGAGCCTCGCGTTCACGCCCGTCCTTCTCGAGCTGCATGACGAGTTGTCTC
TTTCGAGCCTCGTTGATCTCTCCTAACCGGTGCTCGCTCTTGCACTTAAGCTCAGCTCGTGTCCGCTTCGAGTCGTTTTCCTTGATGAACTTCTCGAAGC
GAGTGACCTGCTCTTTCATCTCAACCTGTTTGCGTTCCAGTTCACGCTGTCGGGCTTCACACGCTTCCATGCGCTGGGCGTACTCCTCCTTCATAAAGTC
CAATGCATCGTCGATTTCGCGCATCTCTTTCCGCTTCTTGAGCAGCAGTGTGGACTGGGACATCTGTGAGATGCCCGACACCACGGGTTCCATGTCGTTG
ATCTCGCGCAGCGGGAACTTGCCACTGCGCAGCAGTCGCACAAACGATCAGTAAGTCGCAACGCAAACCAATACCAAAGTCTGCCTTGCATGCATCACAC
TCACTTGGCAATCCGCGCTTCCGTCAAGAAGACGCCCGATACATCGTCCAGCGTGCTGCCGGCGCCGGGATTTGTGTCCTCCATGCTTGTCTTCTGCCTG
TCAAAACCGGGTTGGATTAATCTGAAGTGAAGGACCGCGATCGAAGCTACTTGGTCATGAACTGCTCAGCAGACAGCGAAGTTAGACGCCTTCACCTTTT
GTTTTCGGCGACCTACTGACATAGTCGGCAGTTGGCTGTTAAAAATACCAAGAGAACCGACACGCTACCTGCTCGCTCAGATCTACGAGGTCATACTACC
ACACGACAACCGTAGCTCTACGCAGCTCTCAATATCCCAGCGGCTGCTGCAACAACTTCAACACCTTATTTGCGCGCGTCCATCATGGCTACATTTCCTC
CATACTCGCATCTGATTCGCCAAAATGACATCCCCGTTCACTCTTATCATTGGTCAAAAAGTTCAATCGCTCACGCCCAACCAACAGGATGCTCGGCCAT
TGCCCACCGGAGCTCTTCCACTTAGCTACGTGAAGTGACCGCTATGCAGCTGGACCAGGCCATCTCGCTCTGGCGCGGCCGCGCCGCCGACGCCGCGCTG
CTGGGCGCCTCGTCGTCGCTCGCCAAGGACAACACGCGCCTGGTGCTCGTGACCTCGGGCGCGGACGTGCGCGAGGTCTGCGCGCAGACGCGCAAGTGCG
TCAACCACTGGACGTTCCGCGCTGGCAGCGCGCACGCGCTCAAGGTGCCCGCGGTGCGCCACCCGCACTCGCGCGCGTTCTTCAGCATCTGCGGGGCGCC
CGGCGTGAGCGCCAGCAAGAAGGCGCGCCAGGCGCGTCGCCAGGAGGCCAACAAGACGGCGGCGCTGCCGGCCAACGAGGGACTCGCGGTCTGGCGCGAC
ACGGACCTGGACGTGGCCAAGTGGCGCCGCGCGCCGCTGCAGTCAAGCGCCAAGGCCTTCGCGCTGCTGGCGCACCCACGTCTCAAGGAGGAGGTGCTCG
TGGTGTTCCAGGACGGCTCCTTCGCCACGTTCGACGAGGACGCCCACCGCAGTCTGCACAGTGACGAAGCTAAGGACGTCGCCGCTGCGGAGGATGACGA
TGAGGAGGACGACGACGAGCAGGAGGAGACGGTGGTGTGGGCCTACCTCGAGTCGGACCACGTGAGTCCCATGAAGGGCGGCCTCTTCCTGTCGCTGCTC
ATGCAGAAGACCAACCAGAAGGGAGAGAAGCAGTACGAGCTGCTGGTGTATCAGGTGGACGTGCCGAACAAGCCAAGAAGCCAGGGAGGTGTGCTGGGAG
CGGTGCTGCTCGTGCGGCGCCGTGTCAAGCTCCCGGACGATGTGGAGCTCTCGTCTTGCGCGTTCCACCCGATCACGTTCTCGTACTCGTTCGTGGGACG
CTCTGGCACGTGGTACACGCTACGCTTTGCGCGCGACGCGCTCAGTAACGCGGTGACGCTGGTGGCGTCACAGCAGCTCCCGAGCCTGACGTCGGCGGAC
GCTGACGCGACCGTCCCGGTGCACAAGAAGCGGAAGCTTCAGGGCTCGTCTTCGGGCTACTTGGTGAGCGGCGTGGGAGGTTACGCCTACCTGGTGAGCG
TGGCCAAGGACGCTCCGTCGAAGTACACGGGCTGGGACTCCAAGTTCGCCGTGCCGGTGTCGAACGTTGAGGTTAACTTGGCGGCGGAGAAGGACGCGGA
CAGTGAAGTGGTGGTGGGCCGCAGCACCAAGGACGGCGTCGGCAAGATCGTGCAGCTGTTGAGCGTAGGAACGGGTGATGCTGTGCTTGCCGTCTTCGAG
CGTGGCGTCTTCATGATGCA