Description :
From Genome Similarity Track
Location :
Scaffold_660:6557- 10139
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_660-fgenesh-gene-0.2Ser/thr kinase

Sequence
3582 bases(100 bases per row)
CACACCCGTGGCAACGAGCATGGCTTGGAGTAGCTGAGATGCAATTTCCCGGACCAGAACCATGCTGTTAGCATCCTGTGCAAGGGCACATACAACCGGG
TACAGCTCGTATTCCACAACAAACTGCGAaGGTGCTGCGTGGTTATCAAACAAGCTCTTGAGCATCTTGAGGAGATTCTTGCGTACAATGGCCTTCGGGA
CAAGGCGCAACTtGTTtAGAATCTCGGTCACGAATAGTCCACTACGGCCGAGAGCCTGGTTCAGTCGAACAGACCGCGTGAGCATCTCGAGCATCGGCTC
CAAGACGAGCTCGAGCTCCGAATCCGCGCCACTTGCACGGAAAAaTGCAATGATCTTGAACAAGGAAGGCAAAaGCGCATGCTCCATCTTGACTGTCTCA
TACACGAGCCAGACGCTAAGCGACTTGATCGCATCAGCCTGCCAATATTtGTCTTCAAGGAGGTCAAGAAAGACGGCGACGCTATCGCTTGCCCACAAAT
GCGCACGCGACGTCGGTGAGGCGTGAGCAAAGTCGCATAGCAATGGCAGCGCAAACTGCTTCAGCGGACTGGAGCTTTGGACGACACGAATTAGCGCAGG
CACAACTCCAGCTTGAGCGGCGTGGGTcTGGCGATTGCGGTTCAATCGACACAAGTAGAATAACGCCTGTAAAGTTAGGTTCTCAATTTCACGGCGCTTG
GAAACAGTAGAGGCTTGTGCGCCGTTGAGCAAACGAACGAGAGTCGCGATTGTGCCGGCGCGATCGAGTTTTTCCAACGTCAACGGCTCCATGCTGAGGT
TGCGCACACACTTGAGCAGCTTGACAACAATACCCAAAACCATATCCTGCGGAAGTGGGATTTCTGTCTCTTCAGTGAAAGTCACTAGCGCTAGGAGCAT
GCCCTCAAGGACGGCTCCGTCGCACACATGCTCCTTCACGACAGCGTCACCCTGAGAAAACaCCATGAGCACATCGCACATCTGGTCCAGTTCGTCGAGG
GACCATGGCCGGCGTCGAAGTGTCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTGATTTGAGGTTTCTTCTTCCTTCGCATCATCATCGGAGTTGCAGCAGCGTGTGACAATCTCCTGAAAGACTGTGATGAACT
TCCGAAGCAGTCCAGCCTTGACAAAAaGCcGACAGATGTCATTCTTGGGAATCGTCTGAAGCCGGAAGACGCTGAAAATGCCTTCAAGCGCGATACGTAG
AAGGTCTTTTtGATCGTCCACCGGACGCGAGACATCCaGAGtcAAGAAATCAACAAGAaCTGGCAGGCCGCCACACGCCACGAACATTTGTAGTGTCAGT
GAGCTGGTTCGACAGCTCTGGCGGACAAACTTGGCGGCTtCAAGACGAACCCGTTCGGCCGcTCTATCGTCTGCGTTGTCCTCATGCAACATGAGCATGT
CATGAGAAACATGGGCGTGTCGCTTGGTAAGGCGAATCACAACCGGAACAAGGCCGACGAGGGCAAGATTCtCCTGGAAGCGCTGGTTGTCCTGAACGAT
CGtGTTTACCACACGCAACACAGCACACAAGACGTCGAGCTTCTTCATCTCAAGGGCTTCCATGATGTTCGGAATCACACCTGGTTGGGACATGAGGTCC
CGTTGGAGTGCtACGTTTGCCTCGAACATCTCCTGCAGGCTTGTGCAGGCATCCATGATAACTTGGTCTTCCATGCTCGGGTCCAACAGTGAGAGAAGTT
CCAGAACGCGAGCTGTCGCCTTTTGATGTGTCTCGCGCATGCTCGAATAGTCGAAGTCGAGCTCTTCGTCGTCAAAAAGCACATCTGACACGTCGTGCGA
ATCCCCCATTGGACAGCGTAGACGCAACACACCGCCTGACTCATCATCACCAAAGCCGTCTTCGTCGTCATCCCTCTCCTTGAACCGATCAAGTACGCTA
ATTTGGTCGTTGGTGCCTTTAAGCcGCCTTGCAGCCGCTGCCTGAACAAGTTTCTCTTCGTCCACGTCATCAAATTGCAGTAGATCATCGTCTTCATCGT
CTTCTCGGAAGGCACGAAGCTTTGATAATCGCTTTTCTACGGGGATAAGCGCTGACCCACTCCACGCCCTTTGGTCCTCACGTGCGTTTGCTTCGCCTCT
CACAGTTTCTTGACCATCGACTCCGTGGCTGCCATCGTCATCGCCCCACAGCTCATCATCCAGCAGTGCATTGGCATCCTCCATTGTCAGCTTGAATGCG
CCAGACCCACCACTCAGCGCTGTCCTTTCTACTACCTTGTTTTGGTCTGGATTATCATCTCCAAGCGCAAGAGGTTTCGGCTCCGACTCGACGCCGAACT
CGTCATCCCAGTTTTCCTCGTCCTCATCCTCTTCACCATCCTTGCCTTCTTCTTTTCCACCcTGTTGCTTGTTCCGATACAGCTTGATAGTGTTCAGCAT
TGCATCGCGCGCAGGTGAGGAAGCCACGCTCTGCGCGACTAGCTGTGAGCTCTGTTCAACCTTGTTCTTTGGGATTTGTGTGATCCACGGGTGCAACAAT
AGATCTGCGGCCGAGCTACGGAGACGTGGCTCCTTCATGAAGCACTTCATGaTAAAGTCTTGTAACGCTGGCGAGATACGcTCCGGTAATGGAGGGTGGT
CATCTTGCACAATACGGAAGAGTGCAGCCATCGGTGCCAAGTCAAAGTATGGTGGCTTGGTCGACAAGAGCTCAATGATTGTGCACCCAACGCTCCAGAT
GTCGGACGCGAAGGACCAGCCCGACATTTCAATCACTTCCGGCGCCACTACAGCGAGATACAAGGGTCAGTGTACATTTCCGACAGACAAACTCTACCAA
GACGCACTCCAGTACGGCGATCCGACCACGGAGTTGGCCTTGTTCTGCGTTGTGTCGCTGAGCTTGACGGCCACGCCAAAGTCTGCCAGCTTGACGAGCC
CGTCCTTCGTCGTGAGGATGTTCGCGCCCTTCACATCCCGATGCAATACACCCTGCTCATGCAAGTATGCGAGTCCGCGCAGCACCTGAGCGATGTACAT
GGCCACGAGCGGCTCTGAGAACGACCCGAACTTCTTCATGAACTGTGCGAGTGAGCCGTTCTCCATGTACTCGAGTACGATGTACAGATGCGACGGCGTG
CGGATCGTGTCGAAGTACGTCACGATGTTCTCATGCGAGAGTTTCCGCAGGAGACTCACCTCACTCTCGATCGCCAGGAGCGCCTCAGCGTCCATCTCGG
CCAGCGACACCTGCTTGATGGCCACGGATCGTGCGGACCGCAAGTCTAGGGCACTGTAGACCACACCGAAGCCCCCACGGCCGATCTCATTGCCCAATTG
CTGCGAGGAAACAAGGACCATGAGCCACGGCAACGCGGGGAAACATGGGGAAACCACGTACGTAGTGCTCGCCGACGACGCG