Description :
From Genome Similarity Track
Location :
contig_5:655530- 660434
Transcript NameFunction/comments
g1766.t1XP_008902758.1 hypothetical protein PPTG_09507 [Phytophthora parasitica INRA-310

Sequence
4904 bases(100 bases per row)
CTGTGCCATCGCTTCATCCAACTGAAGGATCGCTTTGATAACGGCAAGTCAAGCCAACTGTGTAAAGTGAGCTGGCGATTGCTGGCCAGTAGTGTCAGCA
CCGCCGTGGGCGAAGAGATCGACGTGGATCAGTGCAAGAATAAGGTACCGAATAATGTTTGATGACGTGTTGTCTCTGACATGTTGTAATCAATTGTTGC
GCACATGCAGCGGTTGTGGCACTCGTACAACAAGGCGCGGGACCAGACAGGAAATGCTACGCCGCCTGAAGAGCCACCGTGCTACGATCTAATGCATCAC
CTATGGTCTAAAAGCAACGGTATGAGCTCGACGCCATTCATCTCATCATCCATTCGACCCCCAGCGTCGACACAAGGCATCGCTGCTCAAGAACTTACCT
CTGATGAGACGGTTAGCCAGTCCATTGCATCATTCCGTTCCTCCGAAAACCCAGCTCAAGGATCGGTCACGACTTAAACCCTCCGTCAAAACCCAAGCCT
GACGTCAAAACCCAAGCCTGAAACACAACGACCAAAGAAAAAGTACAAGACGCAAAGCGAACATGTTGCGGAAGGGATGAAACTTTTATCCAAGAGTATA
TCAGAGGTAGCCTCTGCAATTTCAAAGCCAGCAAGTGAAACCATCGCGGAGACCACGAACCAGCTGGTGCTGCAGACGCTTGCTGAAAGCCAGCAGCGCC
AAAACCAACTAACGACCCAACTTCTGGAACACCACCAGCAGCAATCGAAGGCAATGCAGTTGATGTTAGCCCAACTCACGAAAATCAGCGAGAAACTACC
CGAGAACAAGTGACATGATCCCAGTCCGTTTAGCAATTGCTATTCCTCGAACTGTCCGAGTGGATACTGAATCTGGCTCGTCATTGGGGTCATTATTGGT
AGGCTCGATTGCTTCGTCAATTTCAGTTCCGTCTCCCAGCAAAATGAAAATGTTATGCATGACAACTGCTGCAGCAATAATGCGGAATGCTTTGGGCACT
GTTTTTTCAGCCATAATGGTCTTCAACCTGCAGAACCTCCCTTTTAAAAGCATTCTTCTGACTTGCGAGAACGTTCTCAAGCTTGTCATAGAACTATGAG
GCCTGGATACCCTCATATACCATATTTATCGGCCCCAGTGCGACAAACTGTCCCAGTGCAACACTAACTCATGTGGGGGTGACACCCCTTCCCACACCTG
TTATAATTCAATAGATTTAAAAACTGTCTAAAAGAATATGTTTATTCGCTATCAAATTCAACTGCGTCAACAACACATTCTTCTGGAAGTGAACGCAAAT
ACGTCCTAAATGCGCCTGCAGCGTCACGGGGTCCGACTGAAAGTAACTTAGCTTTGTGAAATCCGTTCACAATAGTCTCTGGGTTGACACTCTCCCATGC
TTTCCCGACCAAATGAGAGAGCATTGCACGCCGCTCACCGGCCGTTGACGGGAAAGGGTGCTCAATGTGATACTTCACGTACAAATCCCTGCTCAGAAAC
AGAGTTAGTAAAATCATCAATCAATCGAAATCCGTGCCTAAAACTTACTGAATCTTTGCCTTGAATGATCGCATGACGCTAACGTCCATGGGCTGGCTTA
AACCGGTGATCCCTGCAGGTATGTACTAGATTTGCGTCACACATTCATCCTCAAGGTGCTCGCGGATGCTCGTCATTTTGTGTACCTTTATAAAAGCTAT
CTAACAGCAGCATCCGGCATCCAGTTATGCTTGGACGCCATACCTACACCAAAGCATATTACAACCAGATGTTAATTTCTTTGTAGTTGCACAAGACCAT
ATTAGAACGTACCTTTTCAATCCATTCCATCATAATTGAATGATCACAAAAGGCTTTTGGCTGCACCGTGTGTATCACCGATGAGTCACCGAAAGACGGA
ACTGACACTTCTTCTGAGACGGGCCCCAGCAAATACGACGAACGGTGCGAGCTTTTTGCCGGTTGCGGATGCACACAAAAACACGTTACAGCCTCCGCCG
TTTACCGCAGTTCCCTGAACAATGTCAACGTTCGCAACCCCGCGGTAGTATACGGTCAAGTGGCCAGGGTTGTCCATACAGACCGCTGTCTGGTCCATAT
TAAACAGTCCAGCATATTTACTATCGTAGGACATGTGAAACGACAGCATACCGTCTTCTTCGACAGCAACATTGACCGAATTTGCAAAAGAGTCGGCAAC
GTCCTAAAAAAAAATAAAACATAGCAGCAAATAGGAAATATGTGCACCCAAAAATTTAATCTTGGCAGCATAATCCCACCTGCATCTCCTTGCGAACATT
GCTGCCTTTGTGTGTAATCCGTCGGACTATGATACGATTGCGCTTTAGAAAACGCACAGCCCACGAGCGAAGCGCTGTGTACTGGCGCGCTGCAGCGAAT
TGACCGTCAAACTTAGTGATCATGAGCGTCAAGCATTTAGTTATCAGGCACAGCTTGCGATTGTTGCGGATCTCTGCTACGTATGATATCAATCTGTACA
AATATAACATTCAGCATTTAGACACCACATATCAGAACATTTCGAGCACTTACTTGGCCTCTAGATCAGGAAAGCGAACGCGTAGAGCCTGGTGTGCGCT
GGGGTCAGCATAGAACTTCCCACTATTTGTTTTGCCAGCAAGCAGGGCAATATTCTTCTTCCACCGATATACAGTCGCGCGATGCACCAACAAGCACTCC
GCCACTGACGCCGCTGAGGCTGTCTCCGCTGCTTGTGCTCCCTGCACACATAACAATTAGTTGCATATCATGTTAGCGCCATTCGATGATAATCTTGCCT
TGATCTTCGTCCTATTCGTGTTCTTCGGTCTTCGCGGCATGGGAGACGTTGGTTTGTGCCGGACGGATGTCATCAAAACCACACTCAATAAAAACCTTAT
GAGGTTTTTTCAAAATTACTTGATTTGCGCCAAAAACATTTGTCGCACTGGGGTCGATAAATACGGTAGGTGATACTCCATGTTCTTTCCGTTGTAGAAC
CGGTACTTAGGGTCAGTCTTGTATGTAGCCAACCGACATGTGTTTTTCTAGTTTATCGATGGAGACCTTGTACTGCTTAGCTACGAGTTTCCGATTTTTA
GGCTGGGAAATGTTGCTAATATACACCATCTTACCGGTTCTACCGCGAACCTTGACTCGGTAGCTGCTCCCCCATTTAGTAGCCCGAATATTTAATCTAC
TTACTTTCTCAGGATCGTAGGCATACATACATACAATAAATTATCGCTTATATTTTCCCCTCGTGGAGTCGTCTTTATAGTTATACTTTTTCCGCTCAGT
ATCGTCTTTATATGTTAGACCTCTAGAAAAAAACTGAAATTAATTAATTCAGAGATACCTGGTAAAAGCCTCGTCGATCATTGGAGCCAATGATAATATT
TTTATCGGTGACAACTCACCGCTCTTAACCCTTTGTCGAACGCTAGTACCACGTGATACTGACTTAAATCTTCAGCGTGGTACTATATCAGTGTCGACTT
TCTATTTTCGCTATTTTTTAATTAATTAGCTAAGTTCGGCTTCGTTCGGTAAGTTCGGCTTCGCTTTGATTAATTTCGTTTTCTTTCCTTACCGCGTACT
TCCTCTGGGCGGAAATAAACGCAACAAGTCTAAATGACAGTTCGATAGGTTCCGCTTTGGGCTTTTCGCAAAAAAAAATGCGTGTGATCACTTTTGGCAG
GTATTGTATGTTGAAGACTCATTCCAGATCAAAATCAAACAGCAACACACTGGGGCGGCCAGCTTCACGCAGCACATCGAGCGCGGCACTGACTGCGTCT
GGAGGGCATGAGAGTGACCGAGGAAGCAAGCCTTGCTTCCTGAGCTTCTCCTTGCCCATGTGAGGCAACTTGTACTGGTTCCTGCCGCTGTCGCGCAGAG
TGCAGATCATGCAGTTCTGCAGAGTCAGAAAGATGTTGTCTTGGGTCGTCTCGCTCAACTCCTCGTACGCAGCCTCGACGGCGTCGATAAGCTCGTCCAC
CCCTCGGATAACGACTTGGTACTGTAGAGCCTGGAGCGCCGCGAACAGTCCCAAGTCGAGAACGTTGAGATCGGGGGAGTTCGGAGGCTGGCAATACATG
CGGATATTCCAGCCCTGCGGCCAAGACGTCCGCGTCGAACGGAGAGACATGAGGTTTGGCGTTGTCTTGCTGAATGTATATGAGCTTGCCGCGGTCTCGT
CGCGGCCAATTCTCCTTTATAGCCGGGATCAAATACTCCAGGAGGTACCGCTTGTAGAGACGTCTGTCGACCGTCTCAACGTTGCGCGTGACAATAGCCC
CCCTCGGGCGATTGACACTCGATCGTTGGGCGACATGCTCCTCGGTGAACGACCAGATCCCAAGCTTCCCGTCCCACGTTGCATTACGGTGGGAATCATG
CCTATCAATCACATGATAAAGTGTTAGAGGTAGCAGAAACTATTCAATCATTGAATATGGCAGGTCATACTCGGTCGCGCGACGGCAGCCAGGAACATGG
TCTTGTTGATGAAGCGCTTGCTTCGCCGGTGCCGTGGTGGCGCTGTTTCGCCCGGCAGGACAATGTACGACCGCTTATCCTTGTCTTCATTAAACCACTT
CTCATCGACATGAACCATGTTGTCCATAGGCTCGAACTCGAGCGTCCGATAGTCGACAAAGCCAAGGACAAACTCAAGCCGTTCCAGCTTGTTTTCCTCC
GAAAGCAGAGGTTTGATCCGCCCTGACGCACGATTCAGCTCCTCCTCGCGCAGCATTGCTCTCACCAGGTACCGGGAGATGCCTGCGTGGTGAGCGGTTT
GTCTCTGGACTTGGCGATCTTCAATGGGGACCGCTGCCACGAGCGCTTGCAGCTCCTGCCGGTCTACCTTCTTCCTGCCGCACCGTTGCTTCTTGCCGCT
GCGC