Description :
From Genome Similarity Track
Location :
scaffold_185:6555- 10871
Transcript NameFunction/comments
Pl_108080type I inositol-3,4-bisphosphate 4-phosphatase, putative

Sequence
4316 bases(100 bases per row)
ACTATGAATACGCTCGACTGCCTCCTCCTGTACCAGGCGGACACTGGTAATCTTGCGGCAGCATGTAGTTTTGCAGCGCACTGAAGCAATACTGTGCCTT
ACCAATGTTCTTCCGCGCGTTCTCGCGACGAACACCATACGTTCGAAGAAGGTTTGTGAATGCCTCGCCATCGTCCGCGAGAAGTCCATGAGACCGCACG
AGAAGGTTCGCCTCTTCAAGTGTGATCGACATAGATGTGCGGTCCTTGGCCGATTTGCACATCGTGACACGACCACCACCAACACAACGGGCGATGGATG
ATGACAAACTCAATATGGCCATGCGCTTGGACCGTCCTGAGAGTTGTATGCTTTCCTTGAGAGCCAACAGCGACGTCTGAATCCGATCGAGGTCCTTGAC
ATCGTATATTGGAGACGAGGCTTCGTCTCTGCGCAGCTTCTTGGAGACCCATTCGGCAAATTTGTTGACGTAGGCCTCTAACTTAACTACATTCTCAACA
TTGATCTCCTTCTGCAGAGCAGCCTTGCCAACTGTATTCGCAACCGTTTGCATCTCATTCATTCCTTGCGAGAAGATCACAGGCACCACTCGAATGGGCT
TCTGGAACAAGAATTTTGCCCGCATCTTCTGCTCTGGCGTTGATAGCGGTAAATAAATTGCCCCAGATATTGCATCCTGCCCTGGAACTCGATGCATGCT
TCGATCAGGAAACTCGCTCGCACGGCGCGTAATAATTGGCAGCTCAATCACGATGCCCGATGGGCCAGAAGTGATGGATACGCGGAAAGCTGCAGCACGA
GGCGACTTCACAGGTCGCAGCTTGATATGAACTCTTCCGAGCTCCTTCACGGCTGCTTCCGTGTCTCCAAGCATTCCTAGTTCATTGCCATACGTAGACA
ATAAACTTTCCACAGAGAAAAGGAAGCCCACTCGTGTGAGCATTTCCAGATAATCGATACCACAGGCCTTCAGTGGATGAGGACCAAAGTCCAGGTGGTC
GTGCGTATGCACGTAAAGTGTTTGCTGGAAACACGTCACAAGAGCACTCATTGCCTGACAGAATGCTACCTCAAGTCGACGCTCTATATCCCATTGGAGC
TCATTGTACTTCCGTTCCAAAGCATCCATGGTAAGATCTGAGCTGGCATGTGCACCTTTAACCGAGCGCGAATGAAGTTTCTCTAACTCCTCACGCATTT
GTCTCACTCCACCACTCTTGAAGCCATACACATGAGCCGCAAAGGCACCAACCGTTGTCGTGCCGTACATCCGGTGCTTGTAAAAAGGGGCGCGGCTTAG
TGCATTCGTATCGATTGTCATCGATGTTTTCTTCAGTTCTACATCGGACATTGAGCATTGTGACAGCGAATAGATATCAGTGCTTGGTCGTGGACACTCC
GTTTCGTCGTCATCTGGATAGTTTATGTTAATATCGGTCATAATATCGATTGCATCAGAAGATTCAAGACCGTAGATACTTTGGAATTCTTCTTCTGTAA
TCCCCATCGCCACAATGGTTTCTGCCAATTTTCGCTGTTCGGAAGGAACGGAAACAACCTGACCTGCAGCCCCCTTAACAATTGTCTCGGCAGAATCAAA
CGAAATCACACGACGGCGTAGTGCTTCAACTGGCTCAAGAGGCGATTCTTCTGTCGGCGAAGGGGACACGCCTTCATTCTCGTCATTGATATCATCGTCC
ACGAATTGCACTGAGTCAAGATCGGTCTGCTGTCCGCGTACGCTTGAAACTCTTGATAGATGCAACGGAGACGATGTGAGTGTCCCGACAAACGAATTTA
CAAGCCGAGCATAGCGCGCGGCACTTGTGTGGTCACCATATTGTACATCTTTTTCTGATGTTGGAGCTGCATTACCTACAGTCATCAACTGCTGATGAAG
GTTTAGCGCCAGGAAACGTAGATCAGCGTCCGCTTTCATGGTGCTTGGTTTAAAAGTAAGACCTGCGTGTTGGGTGGCTCCGTACCGCAGGATCGAGTCC
TCCACTTCGGAGATATATTGCTCCATTTTATTAACGAGATCCAAGCGCCATTTCCGCTTCTTCCGTTCAATAACGTCATCTTGAATCTGTATGATCATCT
CAGACATCATGCCTATACTGGTTGCTGGTTTAACTCGATTCTCCAGGGTGAGCGAGCAGCTCTTTCCGGACGCGAATGATGCCAATGACAACGAGTCTTC
AGATGTCATAGTGCGTCCCAAATCATTTTCTTGGACGGTACCAAGGGCTCTTGGGGAGGATGGAATCACTGAAGGCACTGAATAGCCACCCACGCTAGGA
GTTGAGAGTTGACTAGAGGGTGTTGATGAAGAGCTATCATCTCCATCCTCGAGCGCAATCTCACGTTTAAGTGAATCAAGTTTCACCAGCAAGTCAGAAA
GAATGAGCTGGAGCAATTGATAAGGTACCTCCCACGTGTATACACTTTCAATCAGCTCTTCTTCGACAAGCATTTTACCTTGGGTGCGTTGGGAGGTCGA
TGCAAGACTGATCATCTGCTGAGCTATTTCCGAGTATACTGCGTTATCACTAAGTGAGGAATTCTCAGCGTCTGGACTTTTCATTCCGATGTACATGAAT
GATCGAGTGATGCGCTCAAGTCCACCAGTAGACATCCCGGCATGTAAACTTTTAACCTCCGCTTCGCATCGAATGACGATTTCACCCGACGATCGCGTTC
GAGATAAAGGTGAATACAACGAGAAAATAGATGCCTGCCCAATAGCAGGCGCTGAGCCTGTCATAAACGACGACAGCGGTACAAGTGGGTCACCAACAAG
CCACTGGCTGTTGAGATCCTCCAATGAGTTTTGGTTTCGAACCGAGTACACTGAGGCACGAAGCAGATCCTGTTCACGCATTTCAACGGCCAACATCATG
TGAAAACACGGGTCCTCTGAATGAGAGATCTCAGTCCGACCAATCTCGGCTAGTACTGCACCGGTCTCCGCGTTCATCAAATGGAGCACAACAAACGATG
ATGATTTGACTGAAGACTTCGACGGCAGAGTCAGCTTGAAGCACTGAAACGACAACCACGCGCACGGAGTCGAGGAAACTGATTGCTCTGGCCAACTCGC
CTTGTTCTCCCATCCATCAAAAACTGTCGCTTGCTGTGTCTGTCCTTCATATTCAGCTAAGTCTACGATACTTGTAGATTCGATTCTAGCAGATCTGTTG
ATCGGTTGCTGTTCGCGCTTGCCTCCTCCTAAATGCTGCCGCACCACAAGTTCCAGTCGGCGTCTCGCACGATCCAACACACCATTTCCAAGGCCTAACG
ACAACGGACTCGGTCGACGTCCCACCGTCAGGTATCCACGCTGTAAACCCGTTGGCGAATTCGGCGTTGCATAACTTGACGCCCCAATTCCATCCGAGAA
CTTTCTGGTCGCCACCAACAGCGATCGAGGCATGACTTCCTGCTCTAGCAGCGGCGTCGTCTCGGTCATTCGTCCATTATAACTCAAACTCCTCCTCGAT
GGGATCTCCAGTGTCGGTTCCACTTCCCACATCAGCACCAAGAACAAAGCACACGGCACAATTTCCGGGATAGCATAGCCCACTACAACACACACATCCG
GACTGTGAATATCTCCACAACCTTGATGTGAAAAAGGTCTTTGAATGTAAATAATTGTCCGCAGTAAAAACAACACCGAACATGCTCCCATGACCAAAAT
CGTGAACCTCAGCGCTCTTGTGAGCTTCACTTCCACTCGTTCGTCCAATCTGCGTCGTAGTCCGTCTCCTGAAGGCTTCAGAACTCTCTCCACTCGATGA
CGCATCTTCCACGTCGAATATAACAGTCCTAAAGAGCTCACAAAGCTCCCTGTCGCAATGAATAACACGGGTAGCACGCCTGTCCAGAGCGTTGACCGGT
TGAGTCTTGTATTAGCATGAGCAGCTTCAACTACTTTGGCTTCATGTAGAACTGAGAGACCTAATACTGTGGCGTAAAAGAGGCCGTTAACGAGTAAGAA
GGCGACCCAGAGCCGTCTCGAGCGACGGGAGACCTTGGGGTTGGCGATATCCAGCCATAGTAGCGTCTGGAACAGCACGAGGCTGAAAAAGAGACATAAA
GCCGTGCGGTTGAGCAGATTTCGAGCCAATCCTTGCGTCAGGAACGACGCGGCGCGAGTGATGGCGAAGAGAACCATGAGACGCTGGAACGTGCTGCGTT
GCGAGTGGAAAGAGGAGGCGCGACATGCAGCTACGAGAGCGAGAGATAGATAGAGAGACACAACCAGCAGCTCGGTCGCAGAAGACGCTTGAGGCAGGAA
CACCAGCCCGTCGTCC