Description :
From Genome Similarity Track
Location :
Scaffold_490:6555- 8183
Transcript NameFunction/comments
Hyaar_Emoy2814206putative nuclear LIM interactor-interacting protein
Hyaar_Emoy2814207hypothetical protein

Sequence
1628 bases(100 bases per row)
CACCATTCAAATAGCGCGTCGCATCGCGTGACAGCACATGAAGTGCACACTGCTTAGGGTCCAGCTTCTGCACAATCTCTTCAGCGCCGTAATTCTGCGA
GAAAATAACAATCTCATAATACTGGCACAGTGTCTCGAGGAACTCGTCGACACCCGGACGCTTGGCATGGCGCCAGCCATGCTTCCGCTACTCAAAGAAC
AATCAAAACACACAAACACAAGCAACGCAAAACCATCCAATCAGTTCATACACCCCACTAACAACAGTCCTCTACCATCTCCACCCTATCAGCAACGTAC
GCTCCACTCCGAGTGCACCAGCGTATCTTCTAGATCCACAACCAAGACAGGAACTGGTGGCGTATCTGCTGGCACTTGAGGGATCGGCCAATCCGGCAGC
AATTTCTGCCGCGACGGGTCCGTGAACGGCTTAACTGTCTCCTCCACTTTCTTGCTAACAAAGACATAGACGTCCCCCAAGAACGTGGCGCCCAGCGTCT
CTCGAATGCGCCTCTTCAGCTGCTCGTCCAGTACAAAGTGCCATAGAATGGATCCCGAGATGCCGCCCGCCAAGAGCGCAAACGAGACACGCGCAGGGAG
CGACGACGTACGCACGACTTTGTGCTCAAGACTGTCGGTCGAGTGCTTGGCAGCTGCTTGACGCGCCGCTCGTCGCTCGGCTCGAGGTACGACGTGGAGC
GGCGTGTCCCGTCCGACGTTTGCAGCGACACGAGCAGAAGGAGAAGAAGAGGAGAATGTGGAGCGCTTGGCGGCTGGGACCAAGCAGCGAGGCGCGCCGC
GTGAAGCTGCAGTCGCGCGAGCGCTACGCTGGACAAGGACTTGCAACGTCATGAGATTGTGAGGAGCTCTTTTATAAAAACAAATCAATGGTCGATGTGG
GCGATCATGTGGTGCACACGAAATTAGGTAGAGAATTTTAAGTGTAGTTTAGTGTGTACCACGTGTCGTTGCTATCGTAGGTGTCTACCACATAATAAAA
CCAAGTATGCTGATCAAAAGACCGGTACAGCTGCTGCTGCTGCTTGGGCTGCTTCTTGCGCCGTGCATTGTGGCGCCGGGCGACTATGCGTCCCTGGACC
CGGATGTTGCTGCAGCAGAGGACGAAGAAGACGATGTAGAAGATTCTTCGCACGTTGAAGACGCTGCTGCGGCTGCGGAGGACGACGACGCTGACGATCG
CCACTTCTGGGGCGCTCGACGCCACGTCGAGGGCTTTGACTTTGACCCGTCTCAAGGACTGACGTTCTACGTCGCTGCCGACAGCAGCGCGTGCTTTTAT
CAGGACGTCAAGTTTCTGAAGGTAGCTGGCAGTGGAGACAAAGACGAGGAGCTCCGGGGCGCCTACGTCGTGAGTGCAGCGGACTCGCGCATTGACGTGG
AAGTGAAGGACCCTGAGGGCGGGACGGTGCTCCGTCAATCGGGCAAAGCCGAGAGTGAATATGTGGTCGTACTTAAGTGAGTGATATTCCAGTGGGGGTG
TTTTGGGGACTATTTAATGCTGGATGCTGATATTGGTGTGGCTGGTTTTGGGTATGAGTAGACGAACGGGTGTCTATGAGCTGTGCTTTCGGAATGTAAA
TGAGGACGGCAAGCTGGTAACGCATGTG