Description :
From Genome Similarity Track
Location :
contig_5:655488- 660392
Transcript NameFunction/comments
g1644.t1hypothetical protein

Sequence
4904 bases(100 bases per row)
ATCGGGACGAACGAAGAGAGGGAGACCACCGAAAAACAAGACGAAGGCGCCGTTTAATTGGACAGACCCTCGCATTGACATTCTTCTGTGCCATCGCTTC
ATCCAACTGAAGGATCGCTTTGATAACGGCAAGTCAAGCCAACTGTGTAAAGTGAGCTGGCGATTGCTGGCCAGTAGTGTCAGCACCGCCGTGGGCGAAG
AGATCGACGTGGATCAGTGCAAGAATAAGGTACCGAATAATGTTTGATGACGTGTTGTCTCTGACATGTTGTAATCAATTGTTGCGCACATGCAGCGGTT
GTGGCACTCGTACAACAAGGCGCGGGACCAGACAGGAAATGCTACGCCGCCTGAAGAGCCACCGTGCTACGATCTAATGCATCACCTATGGTCTAAAAGC
AACGGTATGAGCTCGACGCCATTCATCTCATCATCCATTCGACCCCCAGCGTCGACACAAGGCATCGCTGCTCAAGAACTTACCTCTGATGAGACGGTTA
GCCAGTCCATTGCATCATTCCGTTCCTCCGAAAACCCAGCTCAAGGATCGGTCACGACTTAAACCCTCCGTCAAAACCCAAGCCTGACGTCAAAACCCAA
GCCTGAAACACAACGACCAAAGAAAAAGTACAAGACGCAAAGCGAACATGTTGCGGAAGGGATGAAACTTTTATCCAAGAGTATATCAGAGGTAGCCTCT
GCAATTTCAAAGCCAGCAAGTGAAACCATCGCGGAGACCACGAACCAGCTGGTGCTGCAGACGCTTGCTGAAAGCCAGCAGCGCCAAAACCAACTAACGA
CCCAACTTCTGGAACACCACCAGCAGCAATCGAAGGCAATGCAGTTGATGTTAGCCCAACTCACGAAAATCAGCGAGAAACTACCCGAGAACAAGTGACA
TGATCCCAGTCCGTTTAGCAATTGCTATTCCTCGAACTGTCCGAGTGGATACTGAATCTGGCTCGTCATTGGGGTCATTATTGGTAGGCTCGATTGCTTC
GTCAATTTCAGTTCCGTCTCCCAGCAAAATGAAAATGTTATGCATGACAACTGCTGCAGCAATAATGCGGAATGCTTTGGGCACTGTTTTTTCAGCCATA
ATGGTCTTCAACCTGCAGAACCTCCCTTTTAAAAGCATTCTTCTGACTTGCGAGAACGTTCTCAAGCTTGTCATAGAACTATGAGGCCTGGATACCCTCA
TATACCATATTTATCGGCCCCAGTGCGACAAACTGTCCCAGTGCAACACTAACTCATGTGGGGGTGACACCCCTTTCCACACCTGTTATAATTCAATAGA
TTTAAAAACTGTCTAAAAGAATATGTTTATTCGCTATCAGATTCAACTGCGTCAACAACACATTCTTCTGGAAGTGAACGCAAATACGTCCTAAATGCGC
CTGCAGCGTCACGGGGTCCGACTGAAAGTAACTTAGCTTTGTGAAATCCGTTCACAATAGTCTCTGGGTTGACACTCTCCCATGCTTTCCCGACCAAATG
AGAGAGCATTGCACGCCGCTCACCGGCCGTTGACGGGAAAGGGTGCTCAATGTGATACTTCACGTACAAATCCCTGCTCAGAAACAGAGTTAGTAAAATC
ATCAATCAATCGAAATCCGTGCCTAAAACTTACTGAATCTTTGCCTTGAATGATCGCATGACGCTAACGTCCATGGGCTGGCTTAAACCGGTGATCCCTG
CAGGTATGTACTAGATTTGCGTCACACATTCATCCTCAAGGTGCTCGCGGATGCTCGTCATTTTGTGTACCTTTATAAAAGCTATCTAACAGCAGCATCC
GGCATCCAGTTATGCTTGGACGCCATACCTACACCAAAGCATATTACAACCAGATGTTAATTTCTTTGTAGTTGCACAAGACCATATTAGAGCGTACCTT
TTCAATCCATTCCATCATAATTGAATGATCACAAAAGGCTTTTGGCTGCACCGTGTGTATCACCGATGAGTCACCGAAAGACGGAACTGACACTTCTTCT
GAGACGGGCCCCAGCAAACACGACGAACGGTGCGAGCTTTTTGCCGGTTGCGGATGCACACAAAAACACGTTACAGCCTCCGCCGTTTACCGCAGTTCCC
TGAACAACGTCAACGTTCGCAACCCCGCGGTAGTATACGGTCAAGTGGCCAGGGTTGTCCATACAGACCGCTGTCTGGTCCATATTAAACAGTCCAGCAT
ATTTACTATCGTAGGACATGTGAAACGACAGCATACCGTCTTCTTCGACAGCAACATTGACCGAATTTGCAAAAGAGTCGGCAACGTCCTAAAAAAAAAT
AAAACATAGCAGCAAATAGGAAATATGTGCACCCAAAAATTTAATCTTGGCAGCATAATCCCACCTGCATCTCCTTGCGAACATTGCTGCCTTTGTGTGT
AATCCGTCGGACTATGATACGATTGCGCTTTAGAAAACGCACAGCCCACGAGCGAAGCGCTGTGTACTGGCGCGCTGCAGCGAATTGACCGTCAAACTTA
GTGATCATGAGCGTCAAGCATTTAGTTGTCAGGCACAGCTTGCGATTGTTGCGGATCTCTGCTACGTATGATATCAATCTGTACAAATATAACATTCAGC
ATTTAGACACCACATATCAGAACATTTCGAGCACTTACTTGGCCTCTAGATCAGGAAAGCGAACGCGTAGAGCCTGGTGTGCGCTGGGGTCAGCATAGAA
CTTCCCACTATTTGTTTTGCCAGCAAGCAGGGCAATATTCTTCTTCCACCGATATACAGTCGCGCGATGCACCAACAAGCACTCCGCCACTGACGCCGCG
GAGGCTGTCTCCGCTGCTTGTGCTCCCTGCACACATAACAATTAGTTGCATATCATGTTAGCGCCATTCGATGATAATCTTGCCTTGATCTTCGTCCTAT
TCGTGTTCTTCGGTCTTCGCGGCATGGGAGACGTTGGTTTGTGCCGGACGGATGTCATCAAAACCACACTCAATAAAAACCTTATGAGGTTTTTTCAAAA
TTACTTGATTTGCGCCAAAAACATTTGTCGCACTGGGGTCGATAAATACGGTAGGTGATACTCCATGTTCTTTCCGTTGTAGAACCGGTACTTAGGGTCA
GTCTTGTATGTAGCCAACCGACATGTGTTTTTCTAGTTTATCGATGGAGACCTTGTACTGCTTAGCTACGAGTTTCCGATTTTTAGGCTGGGAAATGTTG
CTAATATACACCATCTTACCGGTTCTACCGCGAACCTTGACTCGGTAGCTGCTCCCCCATTTAATAGCCCGAATATTTAATCTACTTACTTTCTCAGGAT
CGTAGGCATACATACATACAATAAATTATCGCTTATATTTTCCCCTCGTGGAGTCGTCTTTATAGTTATACTTTTTCCGCTCAGTATCGTCTTTATATGT
TAGACCTCTAGAAAAAAACTGAAATTAATTAATTCAGAGATACCTGGTAAAAGCCTCGTCGATCATTGGAGCCAATGATAATATTTTTATCGGTGACAAC
TCACCGCTCTTAACCCTTTGTCGAACGCTAGTACCACGTGATACTGACTTAAATCTTCAGCGTGGTACTATATCAGTGTCGACTTTCTATTTTCGCTATT
TTTTAATTAATTAGCTAAGTTCGGCTTCGTTCGGTAAGTTCGGCTTCGCTTTGATTAATTTCGTTTTCTTTCCTTACCGCGTACTTCCTCTGGGCGGAAA
TAAACGCAACAAGTCTAAATGACAGTTCGATAGGTTCCGCTTTGGGCTTTTCGCAAAAAAAAATGCGTGTGATCACTTTTGGCAGGTATTGTATGTTGAA
GACTCATTCCAGATCAAAATCAAACAGCAACACACTGGGGCGGCCAGCTTCACGCAGCACATCGAGTGCGGCACTGACTGCGTCTGGAGGGCATGAGAGT
GACCGCGGAAGCAAGCCTTTCTTCCTGAGCTTCTCCCTGCCCATGTGAGGCAACTTGTACTGGTTCCCGCCGCTGTCGCGCAGAGTGCAGATCATGCAGT
TCTGCAGAGTCAGAAAGATGTTGTCCTGGGTCGTCTCGCTCAACTCCTCGTACGCAGCCTCGACGGCGTCGATCAGCTCGTCCACCCCACGGATAACGAC
TTGGTACTGTAGAGCCTGGAGCGCCGCGAACAGTCCCAAGTCGAGAACGTTGAGATCGGGGGAGTTCGGAGGCTGGCAATACATGCGGATATTCCAGCCC
TGCGGCCAAGACGTCCGCGTCGAACGGAGAGACATGAGATTTGGCGTTGTCTTGCTGAATGTATATGAGCTTGCCGCGGTCTCGTCGCGGCCAATTCTCA
TTTATAGCCGGGATCAAATACTCCAGGAGGTACCGCTTGTAGAGACGTCTGTCGACCGTCTCAACGTTGCGCGTGACAATAGCCCCCCTCGGACGATTGA
CACTCGATCGTTGGGCGACATACTCCTCGGTGAACGACCAGATCCCAAGCTTCCCGTCCCACGTTGCATTACGGTGGGAATCATGCCTATCAATCACATG
ATAAAGTGTTAGAGGTAGCAGAAACTATTCAATCATTGAATATGGCAGGTCATACTCGGTCGCGTGACGGCAGCCAGGAACATGGTCTTGTTGATGAAGC
GCTTGCTTCGCCGGTGCCGTGGTGGCGCTGTTTCGCCCGGCAGGACAATGTACGACCGCTTGTCCTTGTCTTCATTAAACCACTTCTCATCGACATGAAC
CATGTTGTCCATAGGCTCGAACTCGAGCGTCCGATCGTCGACAAAGCCAAGGACAAACTCAAGCCGTTCCAGCTTGTTTTCCTCCGAAAGCAGAGGTTTG
ATCCGCCCTGACGCACGATTCAGCTCCTCCTCGCGCAGCATTGCTCTCACCAGGTACCGAGAGATGCCTGCGTGGTGAGCGGTTTGTCTCTAGACTTGGC
GATC