Description :
From Genome Similarity Track
Location :
Scaffold_222:65521- 68953
Transcript NameFunction/comments
Aphin_H310_13538Hypothetical protein
Aphin_H310_13539conserved unknown protein
Aphin_H310_13541zinc-finger containing protein, partial

Sequence
3432 bases(100 bases per row)
CGGTGATTGCAGTGGCCATTGCAGCAGCGCACGCGCTACAGCGCTACTCTCATACCATCCTTCGCTCCGATCTGTGGCATTTGTTGCCCTGCCGAATTTC
TTCACACGGACAAGTCAGATGGGTTTCCACCGTGCGTCGCCCTGGAGCCGCACACATGACCGGCATGTGCGTCCATGGTTACTTGATGAGGGCGCTTCTA
TCCCCGCATCACATGACTGAAAGAACCTAAAGTGTATTGACTAATTATTCGACGGTGCCGACGGGTGAATGAGTTCCCGGACGCGCATGTGCTCTTCTCG
CACGAGCTTTTCAATCTCGGCAACGTCAGCCTCTTCGTTGAGGCAGTAAATTTGCTCAAACGAGTGCTCGTTCTGTTCAAGGATAACCTTCCACACGTCG
CCGCCACAGATCGTCAAATGCGACTCGACTACCAACTTGTCGCCGTTGGGAAGGTGAACACCGACAACGACAGAGCCCGGGTCGAGTTGGAGCCCGTTCA
CGTCTTCAGACGTCACATTGTACAGCACGCATTGCTTGGCAGTGATGCTGTGGGCCGTCACGTTGATCAAGATCGAGTCTTCGATCGTGACCGAGGCCGC
CGACACACCCGACAGCACGCTGCGCCGAATCGTGCCTTTGGTGATCTTGCTGCCGAGGACCGCAACTTGGTCAAACACCATGCCGGGGCCGATTTCGCTC
CACATCAACGGGTTCGAAATGCCCAGGAACGATCGCAGGGCGGCGGCTTCGGTCGAGTCTTCGGTCACCAACACGTTGTTCTTCAAGTAGTACTTGAGCT
GGCCGTAGTCCCACCAGTACGCCGCGGACCCGACGTCGACACACCCAAACAAGCCGAGCTTTTCCCGACGGGTGGTGTAAAATCGATGAAGAAGCAGCTG
CATGCGTTCGTAATGGGCAGACGCAAAGGCTTGTTGCACACCCTTTTGCACCATCAGCTCCACGTACGACTGCTTGGGCAGCGTGAACGGCATCCAGAAA
TGTGGATCGGTGTCCAATTTGCCCGTCTTCTGTTCCAATTCCGAGTCAAATTCGTCCAGCAGCGCAATGAGGATGTCGTGATCGACCGAGAACGAACCCA
ACGACGTGCCGACCGACTTGAGGTGGCCAAAGTCGCTGAGCAGTCGAAGGGCCGTCGCGTGGCTAACCTTGTCGACTTGAGCGGCCTGATCGTCTTCGTT
GACAGCAATGAGGCCATACTTGTCCAGACCCTTCGCTTTCCACTCAGCTTCGGTAGGCATTGGCGCCAACGTCGCCAAAATATCAATGTGATGAGTGGGG
GTGTAATGCACGGGGGCGGAAGGAATAAAAACTTGGTCGCCCCAGTAGACAGACAAGCGGCCGCGGCGGCTGGCAGCATACACACCAGTTTGCTTGATCA
CAGCTTCCAAGATCGTCATTGGGACGACTTCGTCGTCAATGGTGATCATGGCAGGCAGCTTCACACCGGGTTTGTTGTTGTTTTCACTACCCGGCAATGG
TGCTAGCCGTGTGCCTTTGCCGGCGGTGTGGTACAACGCAACGGACACCGAGCCAGCTTTAAGTTGAGCAGTCAGGTCGAAGGACGGGCCGTACACTGCT
TTGCCTTCGGCAACAGCTTTTTGGTACGCATAGAGCGTACCAAGTCCGTTGCCTGCGCCGCCAACCCAGTCTTCGTGCACTGCAATGACCTTCATGTTTT
CGGGGGAGATCTCGCCGCGGGTCGCCATAAGGCGCTTTTGCCAGTACTGGGCTTGCATCGGCGTCGAACAGCACACAATCACGACATCGTACCCTTGTAG
GAGGTTCATGCATTCAATGTTGGCATTGATCACGGCCGTAGTCGCGGACGCTGCGGTCGAAGGGGACGCTGGCATGTGGAGACGAGGGATTGAGGGAAGA
AAAACGACTGTGGCGACCCCAGATAAAATTTGTTGTCTCGACGTCCTCTGTAAGTGCGAATGTCAACAACACGACGTTTAATACGTTTAAGCCTTAACGG
CCCGACAATATGCGTTTTTCACAATCCCCAGATATTATATTAATTCATGATTTTCCCCTCTATTCAGCATGAATGAATAGTTGGTTGAATTCTTGTTAAC
GTTTCTATTTTGACAAAGTGTTAAAACAAAACACGAACTCAAGAGAGGCGAATCTCGTAGTATGGACATTTACTCATTTTGATTGGATGAAATCTTCCTG
ACGAGGAAAATCACCCAATCAAATGCGTACATTGTGTAAAGTGCGAATTACTACTGCTTTGGCCACTTGCTGCAGTGAATATGCCAGCTCTACTTTCCAA
TATATTGCAACGGAATATCCATGCTATGGTAACGATTAATAATATTCTTTTGTATGATGTTGCATATTAGTTTTGATTAGAGTACCTGAGGTTGCTGTGT
AATGGGTTCAGGATCGGAAGGGCTTCCATGGATTGGTGTCGACGGGGGTGAGACACAGCGCACCTCTGCCACGAATCTGGCATACACAATCGCAGCACTC
TCAAGGCAGAGGAACATCAAGGGTGGTGCGAATGGGGGGGGGCTTCCTACCAAAATAGCAAGGCATATTCCAGTCCAGGCGTGCTCGATGCAGCTCACAA
TGGGATTGACTTGACATGTGGTCATCCTGCGTGAGGCTCCAATCCACAGACAACGATCTCATGCCACAGACTTCAAGCGCCAATGTCGCATAGGTGAGAA
CTGACCCCGCATTGAATATTTGACTGCATTCACCTTTCCATGTTTGCTCGAGGAAAGGTTCGTGGCAGTCTCCATGCAGAGAGCAACAGGGTTGGACAAT
GATATACCCTTTTAAAGATAATTATTTCTTACGAAGGGAAAATGTCTACGTGGCCCAATTGGATAGGGCATCCGCCTACGAAGCGGGAGATTGCGGGTTC
GAGTCCCGTCGTGGACTTATTTCCGCTCACATAAAGCGCCAACCGCTCAACTTTGCCTCTGTTTTCTAGTACAAATTATGAAGTACTCGTTTTTCATGGT
TGCGGCGTGGATTTAGAGATGATGGTTGTTCGTAATCTAGAGTTTCTCCACCTTGTTGAAGTGCCCCCCGCCAGGATTGCGCTTGGCAAGCTCAGCGATA
TCGGCGGCCTTGTGGTCGAACGTACACTCGTGCTGGTCAGCGTACCGATGTATCCCGCAATACACGAAGCCGCACCGACACTCGATTCCTGTAAGGCCGA
TCTTTTTTTTGCATTCCCAGCACCTGGACTTGTTTGTCTGCACTGGTTTCTCGGGAGGAGCTTCGTCGTTCGTCGATGATGTTCCTGCCTCCGCAGTCGT
TGTCTCCACCATCGTGTCGCCCGTGGTCGTTCCTGTTGCTATGACGACGGTATCTGGCTCGATCACTTGATCAGTCGCAGGCGGGGACGGCGCGCTCGAC
GGAGCTTTGGTACCGCTCTTCTTCCAGCACAC