Description :
From Genome Similarity Track
Location :
Scaffold_117:65497- 67036
Transcript NameFunction/comments
Phymu_g4753cystatin-like cysteine protease inhibitor domain-containing protein

Sequence
1539 bases(100 bases per row)
TATCTTTCAACTGCGTGCTTGGTGAGCGGCAAGAGGAACATCTCCAAGCTCAACCCCACGCAGTAGACAAGCGACGTAATGATGAAACACGTGCGATAGC
CATACGCATCGATGAGAAATCCACCTAAAACTGCGCTGCCCGACCAGGAGAAGACCGAGAGACCTTCAAGCGCATTCCAGCGCGCACGGATGTTCTTGGG
CACGTAATCCATCAGGATGGAGCGACGCAGAGGCTGCGAACAGCGCATCATCCCTCCTCGCATCAGGAACAGCGCAATCTGCAGAGCCAACGGCTGCGCG
TAGGCCATGGAGAGCAAACAAGCGACGGAGAAAGCCCGAGTGAAGGCGATAATGGGCATCCGGCCGCAAGGCTTCGACAACCGCTGCGCAAGGAACGACA
GGATCATGACGACGAGCGGTTGGCTCATAAAGAGCGCGCAGACATGGATGGGGGTGAGGCCGTACTCctccttgaagaagagcgggaagaagttgatggt
CATGCCAGCGCCGTTGCTGATCACAAAGTCCGAGACGAACAGGATGTACGGGACGTGTTTGGTGCGGAAGCAGAGGAACTTCGCGTCGAGGTGAGCCATG
TAgccttcctcgtcgtcctccacctcctgcaggcgctgctgtcgctccaGATCCAATTCTTTCGCAGTTTTACCCTTCAATAACAGCAGTGCGGTGTTCT
CTGTGGCTGTTGGAGGAGATTTATCATCCACTGTGatgtcgtcttcatccgagtAGTCGTAGACCATATCGAGCTCATTGCCGTTGCCGACCAGCTTGGG
CGTACGTAGAGGCGAAGGAGTGATCATTTTCTCTAGTagcacttcctcctctttctcctcttccgTCTTGTCCAGTAAATAGTCCTTTGCGCGGTCATCA
TTGAACTGGAACAGGATCAGTGAACCAATGACGGCCAGCACACACCCGAATTCCAGCACCGGCTTGAGCTCTGGCAGTTGCCACTGGTCTCCGtagaaga
ggaagaggaaaatGCTCAATGCAGGGCCCAGCATCTGCGCCAAGTTGCTGATGTTGTACTTGATCATGAACGGGAAGCTGCGCTTTCCAGGAGGGATGGA
GTCAGCGAAGAGAGCTTCCATGGCAGGACTCTGGAAGGCGGCGAAGAGGCCCCAGAGCCCAAAAGCCACGTACAAACCGTTTAAAGACGTAAATTCCACG
GAAAAGAAGGTGATGACGGCTCCGAAGGCGCCGATGGCGCCCGAGAGCTTGAGGATCGTGTCTCGACGGATGCGGTCAGCGAAATAGCCGCCTGGGAAcg
agaagacgagctggGAGATGCCCTGGATGCCCTTGACGATGCCCACGGGCTTGTTGGATTGCGTCAGCACGAACACATAGCCAGCTACGacctgctggaa
gagaaTGCTGCAGGTAACGAACGAGGTCAGTAAAATGGGAGGAATTTGAATTGacacattttttttttttgacaGACCTTCGAGcggaccagaagaagag
cgtgaagACGTAAGCAGTCCAGACGTTGTGGGTGACGCC