Description :
From Genome Similarity Track
Location :
scaffold_532:6549- 13215
Transcript NameFunction/comments
Pl_104048hypothetical protein PHYSODRAFT_545950

Sequence
6666 bases(100 bases per row)
ATCTACGGCGCGCTGCCAGCAGGTGACTCGTACATCTGGTAGTTCGAGTGCGACTTAGCGCGCGAGCGGCTGAAGTTTCTTGAACGAGCACTTCCCGGGG
TACGCGCACTGCGACGGGATGCACGGATGCGGCGCAGACGAGCACGTTCGGCTTCCATTTCGCCCTTCGTGCAAACCATGCCATTCTTGAGTGTGCCCAC
AGTGAACAAAAGTGCCATCGACACCACGCAACAACCCGTCAACGCAAAAAGGTAGAAGTACTCGTCACCACTCATCGAATCGCTCGAGCGGATGTAAGTA
GCGCACACTGGCAACAGGAAGAATACCATGAAGTAGACAGTCACGTACACCGCGCGCTGCTTAGTAGTGAACAGACCGACGCAGGACACCCATGGCACAG
ACGTGATACCCAAACCAGCGAAGAAGTACAACAGCAGACCCACGATCTGAAGCATCAAGTACTCGCTGTCGCCCGTCACGAACTCCGACTTGTCGTTTAG
ACCCAGGACGAACACAAGAGCAGCCATCGGCAACAATGTGCAGAACAAAATGCGCTTGTGGTCGATGCGGTCCATGAAGAAGAACGAGAACATCGCACCA
AGGAACTGGAGCGCCGTGCAGTTCACGAACATGTACGTCGCGTCTTCAATACTGCGGAACGTGTCTGATAGGTACATGTTCACGCAGCCCAAGAAGATAC
TGGAGACCAGCATCAAGAACAGGCCCATCATGAACTTGAGGAACGATGTACCACCGTTGGCACTGGAGTCGTCACTACCAGCCTCTTCGTCGCGGATCAT
ACGCAGTTCCTCAGACACACCCTCCTTACGACGCAACACAGCTAGGCATCGCTCGCACGACTCCAAGCCCTCGCGCATGTACACCCAGTACGGACTCTCC
GGGAAGATGTACACCGCCGGAGTCATGATCGACAAGATGATAGTCGCAATGAAAACCTGCCACACCCAGCCAACTTCATTCGACGATGAAGAGAACCAAG
CGGCGAACAAAATGCCAAGAATGAAGCCACTGCCAAGGAGCAGAAGCGCCTTGCCGCGCATGTCGCGAGTGGAAATCTCGTAGATGTACACAGCCAGAGT
AGGCAGAAGCACACCGACAGAGCCACCAAGCAAGCAAATGCCAGGCATCAGGAAGCCTTCGCCACCCGACTGCACAGCACTCACACCCAGCATACCCAGC
ACCGTCAACAGACCACCGAACACGATAGACAATCGACGGCCGATGAAGTAGTTCAAGAAACCAGCCACAAATGTGCCTACCATGCACGCGAAGTAGAACG
CATACGTGACCGAGCCGTCACCGACGTTGCCATCAAGCAGATCATACGTCGTAACGTAACTTAGGAATCCAGCCGTGCTCTCAAGCGTCGTGAACAAGTG
GAACAACCATCCACAGCCCATGCCACCAAGCATACCCATGAAGGCAGCAAGTGAGAACGCGTACTGCGATGAAGCCGAAACGACCTCCGAGAAACCCTTG
TTGTACATCATACGCGTCTGGATAATATTCAGGAACGGGATGGCGGACATCACTAGCAGCGGAATGATCATTGTCACTGAGAAGACGAAGTCGAAGAAGA
ACGCGAGCTGCTGGAACATGCCGATGGTCGCGATCGATGAGTTAGCAAAGCTGTACATGCGCGCCATCTCATTGATACCGTAGAGAGAAGCCATGTAGCC
GAAGAATAGAGAAATGGTCCGGGTGAAGCTGACGTCGAAGATGGCGATAGTGAGGACGAAGAACACAATAAGCGCAAGGACCACGATGCCCAGATACAAC
ATCGCACGAATAGACGAATTCACGTTGCGCATACAGGTGCCCGCTGCACCAAACAGACCCATTGCTAGAACCGTGACAATCGAAGAACCGAACACCAGTG
CAACCGAAAGGATCTCCCATTCAAGCGCCACCACATACCACATGAGCAAGAAGTGACGGCATTCGCGCAGAATGACCGTCAAACGAGCAATAGGCTTCGT
GTTGTGATACAGCTTGAGCTCACCCTTCCACCAGCCGATCCAACCGCCAACCATTACCGTGTCCTTGTCCTGGTAGTCCTCCGCAGCGTACATCCACTTA
GCCCACGCCGTCACATCAGCCTTGGTCTTCTCCCAGTCAAGTCCGTCAGTGTTAAAGATGTACGGAGATACCAGCCACACTACTGCAATAACCCAAATAG
CAAATGTTTGCACACCGAAGCTCTGTGATGTCTCACAGTAATCAAAGGCGAACGAGTTCGTCTCGCCAGCAACAGAGGTGTCACAAATGTCGAACTTGCC
GAATGCCAAGTATACCAAGCATAGACCAATTAGCTCCATAGCCTTGCGGTAGTGACTCGGAGCGTAAGCCTTGTACAACAGCACAAACGTCTCACGGGTA
ATCTTAAAGCCACGTCCCGTAGCCTTGTACTGAGCCTCACCGTGAAGCAGGTTATTATCGAAGAAGTGCATTGTCGTACCAAGCTGGAAAATGAAGAATG
CTGGGCCAGCCGTGAACACCATCTCCAAAAACTGCACGAGACCGCGACGCAGACCCATTTCAGCAAAGTACACACAAATCAAAGGCAAGGACAGGAACAG
ACCAGCCTGAATGTAGTACTGTGTGTTGTACACAGAGTCCATGTCATGGTATACACGGTCGTCGAAGCCGTAGTTCTCCGAGTTGTCCATAATGATCTCC
GTAGTGTTCATGTTGTACACAATCTGGGTCTGTACGCCCGACAGAGCGATGTAGACCTTGCAGTACATGTACACAAACGTCGTCACAATCGTCATCCACG
TTGCGTAGTAGAAACCCGTGTGCGAGTAGTACATCGAATTCAGGCGGAAGAAGTCCATGAATTGGCCCATGCGGTGGGCCTCACGCGCCAGCGAAGTTTC
ACCTGCACCGTTGGCAAGCTTACCTTCGAACATCGAAATCTGTGACAGGGCCACATCACGACCCTTACCACACTGCATGAATTCCACGTGGGTCACGACA
CCGCCACGCAACGTGCAGTTAAAACCAGCGAACACATCCTCCGACAAATTGATGCCCTTACTGGCTTTCGACACACCACCGCGCGTAATAGCCAGCACCT
TATCGAACACATCCGGGTGACCGTAGTGCATTCGCACGTACAGAGGGTCAGCAAGCACACGCTGCGACAGCGTCACGAACACAAGTTCCTGCCACGTCTT
GAACTTGGCAAGCGAGCTGGCATTACCCGTGAAAATGTGCTCGCGCATACCAATGATCGATACAGGCTTCTTTGATGGATGTAGATCAGCCGTGCACAGA
AGCTGTGGCATCTTCAGACACTCTTCGAAGTAGTGCTGCTGGTTCATATCAATAGTCTGAACGAACTCACCACGCGTGAACGGGGTAGCGTTGTTCTGGT
TTTCAGGCTTACCCTCGCCAAGAATCGGGTCACCGGGAAGCGAGTATCGGTACACTTCAACAATCTCATCGGCTTCACTCTTAATCAACACAGTGTCGAA
CGACTTCTCACCATTCTCATGCTCAACTGTGTCGACATAAGCCACACGTAGGTTCGGGTACTCGCGCAGGAGGTAATCAATGTCATCGGCCTGAGCCTTA
CCCTCCATGCGGTGCTTCCCGTACACCTGACAAGCGCAAATGTACGAGAATTTCAAGCGCACCATATCCTGCAGCTGGTTTTGCTTCTGCTCGGCACTCT
TGCCAGAGCTGGAGCCAATTTCTAGCCAGTGTAGAATCTTTATCGCATCCTCGTACATCATCATACCCTGAACCGTACGAGCCAGAGTCTGACCACGGTA
CGACGCCCACAAGCGAATCTCTTCAGGGTGGTTCTTCTGAGCCTCCTCTGCGGAGCTCACGTCCACACGCTCCAAGAAGTTGTCCCATTCCTCCTGGTGA
ATTTTCGTCAGGTACTTCAAAATCGTTAGGTTCTTGCCATCTTCCTCGACCTGCTGGAAGATCGGGTGGTTCACAAGAGGGTCGTTTAGGTCCTTAAGCG
AGAACAGTACCGTCTCGGCGTAGAACGGCGTCACAACCGAAAAACTGCGCATTTCCTTGATGGAACGCAGCTGAGGGATGTCCATTACAAGCGATTTCAT
GAAGAAACCAAGACGACGCTGAGCCTCAGTTGTACGGGGCATAGCCTCCGAACGGTCCAGCGAAAGTAGCAGGCAAGCACGCGTGGCAGCACCCATAGCT
GTGTCACTGCAGAACAGGTTGACAAGTCCGCGCGAAGCAAACATGTAGCCGTTAGCACTCGAGCAAAACTTCGAGTTACCAAACTTGCGCTGGAGGGCAG
GGTCCACGCAGAACGACTGTACTCCATTTAGGAATGCCTCCATCTTGGAAACAAAGTTGCGGATCACACCCATTGAGTGCACACGCGCGTTCGGAATGTG
TTGGGACTGTGAGTCCGGGTCCGGTAGGTCCAGAATCTCTTCCAGAAGATCAACAGCGGCAACACGCAGACTCGCAAGCTCACGCACGTTGAATGACTTC
AGGAAGCCACCGCTAGAGGCAATTTCCTCAAGCATGCGGAAACCGTCCACCACATCTGCATCATCGTTGCCAAACAGAGCGCTGATAACGTACATACTGG
CAGTGAAGAACGAACGGATAGCCGATAGGCAGTCGTTCTCAACAAGCGTCACACGAAGCTGTGACTCACCCTTGCCATCCTTAGCAGTCTTGATAGCCAG
GCCCATCGCCTCGGTCAGCTTACCAGCTGACAGGAACACGGGCTCAAACACTTCGCCGGTGCTGCGAATATCGTACTGAAGAATAGCAGCCTCCTTGTCA
TCCAGCAGATCACCCTCGCGGAACGAGTTCACAATCTCGTTCCACACCACAACGAAGCGCAGCATCATCTGAGACTCGTAAGCTGCAGCCAAAGCGCTAG
CACGAGTAGAGTCCGTGCCACTAGCAGTAGCATCGCTCGAGCGCGCTAGAAGCGTCACCACCTTCTGGTCGAATAGCTGAGGAGCGACACGGAAAGCCTT
GGTCATTTCCTTGGCTCCACGGATTTCACCTGTCTTCATGAGAATACCCTGGAATCCACCCAGCAGTGCCTGGAAGATCGTGAAGTAAATCTGCGTGGCG
TAGTTGAAAATGAACACCACAGGCAGCCAGAGGGCAATGATAATACCAATGTTGTGGAACGACACCAGCGAGTTCTGGTAGTCCAAAGTCATGGCGTAAA
TGCTCAACGTCGGCAACATCAGTGGACGCACCAGAATAAAGTACGATGCAATAGCCTCCACGATCCACAATAGGATCCAGAAAGCAATATACTTGACCTG
GAACGAGAACGGAGGCGTCATGTCTTGACCGACATAGCAACTCTCACCTTCACGAACAAATTTGGCTGCAAATGTGCCATTAATAACCTGAGGCGCGAAC
GCCTGTGTGAGCAACACCAATAATCCTGGTAAAATGTACGCACCACAGAGTGGGTACAAATTATCCAGCAACGTCGTGTCTTTGTCTTCATTCAGTGGCA
CGTAAATCATGATACCAAATAAAACAGCAAAACCACCGTTCCAGATGATACGAGTGGCAAGAGCAGAGCCGTATGTGAACGATCGAGAACTTGTTGCCGA
ACTCTCTTTTGAAATGAGCAAGTGCCATCCATGACACACTTCCATGACACATTTGAGGAACGCCATTAAACTCAAACTGAATGGAATTGCAACAACTGCA
AGTTTCAAGTCACGAGTTGTATAAGGGTCCACCACATCTCCAATGCGTCCGAATTGGACCCACCCACTTTTGCCACCATCAGGTGAAATGGTGACTGCAA
AAGCCAAAACCGTGAGCAACACCAGAAACATCATGTTGAACTGGAAAATACGGTAATAGTTCAACACCATGGTCAGAAGACTTCGGTGTTCGTAGAATGT
TTTGCCATGGTTTTGCGTCAGTTCCTGACCCACTTGAGTCACGGAGATACTGAGACAATGTTGCTTCCAAAAGTACTCGTTGATATCGTCATAATTGCGG
ATTTTGACGTGTTCCAGAGGTTTACCCAGTGCATTGCGACGTTTCATGTTGCTTGCTTCCCTCCAAATGGGTCGAATTACTTGGTCCAAGTACCACCCTT
CTTGTTGCCGTTCATGGCCTTGAGGGTCTGCATTCACCATCGTGAGCATCTGATGGAAAAGGTAACACAAACATTCGGGCATGTGACGGACATTGGCAGA
TTCTCCCCAAATGAGAAAGTAAAGCATCACATCCATGTGCAAATTGCCAGAAGGTGTAGAATGCGGAATACCACTTCCCGTATACGTCACTGGTTGCGTG
TGGATGAATTTGCACCATGACCGATAATTGCTCAACAGCTTATTGGCCAATTGGACGAGGTGTTGGTCCGCCGCGTCATTCGGCAAACAACGCGCTTTGC
CATTTGCCAACAGAAGCAAAACATGTTCACGCTGGTTGCTCACCGAACCCTCTTGGAATCCGAATTTAGCCTTGAGAAATTCGCAACAATAGTCAATTGC
CGCCTCGTCGTCTTGCGGTGCACCTTTGAAGCTCGAAGGCGTCACATCCATCGAATTGAGGCGCTTGCTGAAGCGCTCCGACCGCTCCGACTTGTTACGA
CGTCGATCGGCGTCCAGCTCGAAGTAATTGGAGCTGGCGCGTCGACGTCGGTCCATTTCGCCGTGC