Description :
From Genome Similarity Track
Location :
scaffold_993:6549- 7719
Transcript NameFunction/comments
g10790.t1 hypothetical protein PHYSODRAFT_486841

Sequence
1170 bases(100 bases per row)
GCCCAGACGGCCTCGTCGGCGTCAAAAGCACCTGTGAAGAACGCGCTGAACCAGGAGGTGCAGCACGCTAAGTTTGAGCACCCGGAGCTGCTGAGCACTT
TCCCTCCAACTACGTACGACCCGATCCCTGTAATCCCACACGAGGACCGCGCGCTTAAGGCCAACCCGACGTTCAAGAACCTGCTGGCCGACGCGACAGT
GACGCACCTGGAGCCGAAGATCGGCACGGAGATCTCGGGTCTCCAGCTGCACGAGCTGACGTACGCACAGAAGGACGAGTTGGCACTGCTTATCGCTCAT
CGTGGTGTGGTGTTCTTCCGTGACCAGAAGATCGATGCCGAGCAGCTGCTGGATCTGGGTCGTTACTACGGCCCCCTCCACATTCAGCAGAACCTGGCTC
ACACCGAGCAGTACCCTGAAATGCTGGTTGTCGAGAACTCTGTCGAGACAAGTAGTGCGGTAATTAAGCGTCACTTGTACGACCCCGTGACTACGTGGCA
CACAGACGTGTCCTACGAACGGCAGCCACCGGCCTACACGCTTTTTAAAGTACTGACGAGCCCTGATGTCGGTGGAGATACGTTGTGGGCGTCTGGCTAC
GAAGCGTACGACCGACTTACTCCTGCTTTTCAGAAGTTCGTGGAGGGGCTGGTCGCGGTTCACAGCGGCAAGGTACGATACGTCTGCTACTCTTTGAGTA
ACAAAAACAACTGATATTGTGTACATGATATGTAGAGCCAAGCCGAACACGCGATCCAGGCTGGGCGCATTGTTCGTCGCCCGGTAGTAGAGTTTGAACA
TCCAGTTGTTCGCACGCACCCCGTGACGAAGCGCAACGCCTTGTTCGTCAACTCTGGATTCACCAAACGCATCAAGAATCTATCTTCCGCTGAGTCAGGT
ACCAATTGACTTTTGGAAAATATTCTAGTGCTGTGCTTTAACTCATCGATAACATCCCTTATAGATGCGGTACTGCAATTCCTCTACAAGCATGTCTCTG
AAGGCCATGAGTTCCAGGTCCGCTACCATTGGACGAAGGACGCGGTGGCTATTTGGGACAACCGTTCGACGTTCCATTACGCCACTTTCGACTACTTGCC
TGGCAATCGTCATGCTGTTCGTGTTACGCCGCACGGCGAGGTCCCTTACTTCGACCCAAAAGCCGCACCG