Description :
From Genome Similarity Track
Location :
Scaffold_865:6548- 7731
Sequence
1183 bases(100 bases per row)
AAGAACGATGCGGAGTGGTGTTGGAACACCGAGCATCAAGATGCGTTCGCGGTCATTAAGGACAGTCTCCTTCATGCGCCTATTCTGGCTCTGCCAAACC
CCGCTTGTCCGTTTAGTGTCGTCTATGACGCCTCGGACTTTGCCATCGGCTGTACACTGCTGCAAGCAGCCGCCGAGGGGCGCGGGCGCGTGGTGGCGTT
CGAATCTCGCCAGCAGAAGGCTGCGGAGAAGAACTATCCTGTCCATGACAAAGAGCTACTTGCGATGAAGTATGCGCTCGTCAAGTTCAGGGTGCACCTG
TTGGGCTCACAGCCGTTCGTGATTTACACGGATTATGCGTCGTTACGCACTGCGACTAAGTCGCCTCACCTCTCGCAAAGGATGGCCCGTTGGCTGTCCT
TCTTCGCGGAATACAACTTCGAGGTGAAGTACAAGCCTGGCAGTCAGAATTTCCTTGCTGACGCGCTGTCGCGCAGGCCGGATTATGAGCTGGCTCATGT
AACGACCGTGACTTCGTCATTACCGGATTTGATCCGAACGGCTTAGGCCAAGGACGACACCTATGTCGCGTTGCTGAAGGCTCTGGGGAGCAAGGAGTTT
TAAGAGTCGGACATGGAATTGTCAGCGCGGCTGCGCACGCGGCTACACCGTTATTCCCTCGATGGAGGCCTGTTGTTCTACAACACTGGCCCCGAGGATA
CGCCCCGCGTGGTCATCCCTCATGATGAGGATCTGAAGTACCGCATCCTCTATGAGGCGCATGACACGCCGCTGGCCGGCCATCTTGGCCGTGAGAAGAC
CTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGATGTACAAGTGGACGAGCACTTATGTGCGCACGTGCGAGACGTGACAGCGCGTGAAGTCGTCA
CCTCATGCTGCAGCGCCGTTGGCGAGCTTGCCTGTCCCTTCGGGCTGTTGGCAATCCATGAGTATGGACTTTGTGTTTGGCCTGCCGGCGGATGCGGCGG
GCAACACTGGAGTCGTGGTCTTCGTGGACCGACTGCTCACATCGCGCCTGTGCCGGATACCATCGATGGTAAAGGTACAGCAACGCTGTTCTTGGACCGA
GTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCCGCTTCACGGGCAGCTTCTGGAGCGCGGTCTT