Description :
From Genome Similarity Track
Location :
Scaffold_37:654639- 658476
Sequence
3837 bases(100 bases per row)
GGCAAGCTCAGCGGGCTTGCGGACGCCCTATCTCGGCGTCCAGACTACGAGTTGGCCCACATCACACGGGAGACAACGGATCTATATGATAGGATACGCA
TGGCGTATCGGAACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTAGCAGCAGGAACGAGGGCGAAGTCCGACTGGCTTTCATCGCTACAGCGCTCCCG
GCTCCACCGATATGGGCTGAAAGATGGCCTCCTCCATTACCGTGTGGGGCACAATGAACCTCCACAGGTGGCCGTACTCAACGACGAGGATCTGAAGCTC
GACATCCTCGCGGAGGCGCACGATGATCCGTCCCGCGGCCACTGGGGCCGCGAGAATACCTTTCTGTCGGCGCCGCTGGCCTTCGGGTGGACCCACATTT
AAAAATGGGTCGCACGATACGTGAAGCCATGTGAAACGTGTCAGCGGGTCAAACCCGCAGGGAACGCTTCAGCTCCACTACAGAGCCTGCCCGTTTCGGA
TGACAGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGCGATTTTGGTGTTCGTGTGCGGATGAGCAAGA
TGGTACATCGCGCTCCAGTACCCGTTAGCGTCACAGGCGAACAAACCGCAAGGTTATTTTCGTGGATGGCGTGGCCCGCTATCACGGTCTCCCGAAAACG
ATTGTCTCGAACCGAGTTCCGTGGCTCACGGCTGCGCTTTGGCAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACCGCGGATCATCCGC
AGACAGACGGCCAAACAGAGCGCGTTAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGACAGCACCACGTACGTGGTCGACGCAGCTTCCAGT
AGTTGCTTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGCTCTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTCACTCTTCGA
GGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGTAAAGCTCTTTCCTCCCAGGTCTCAGATGTGAGACCGGTTTGGCGGCGGAAACAAGTGG
ATACCTTTGTGTATGCCAAGTTAAGCGTTATTGGCAGGTTCCGCGGTGCCATAGGAGCGGCCCAAGATAAACAAAAGGAGCACTCAGACAAACATGGAAG
AGAAAACTGAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCCGTCGGCAGCCACAAGCTGAAG
CACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGTGTCGTACACCATCGACCTTCGAAAGTCAATGACGACGCACCCGACGTTCTATGTTG
GAAGTCTTAAGCGGTACTTTGACCCTCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAG
GGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACG
CCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGAT
CATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGAGACCTCCCGCTCCAACAAGACCAGGCGACGCGCA
AGTCGAGCGAGCACGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACGCGCTGACCGAGGC
GGCCAACCTCAGGGCCCTGCGTCGGACCCGCCGGAGAAGCACGAGGACGAGAGTAGCGTTCCGAAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTC
CGCTCCTGCTTGACCGGATCGGAGAAGTCCACTACCACGTGGAACGGATTCTCCAGGAGCGACGGTGTCGCGGTAAGCGATAGCTCCTCGTTAAGTAAAG
GGGTTATGCCCACTCTGAGAGCTCGTAGGAGTCGATTGAGCGGCTTCATAAGTTGTTCGGGGCTTCTTGCCCGAACGGGGTACGGACGTTGACTACACTT
CGTACCCGCACTCGTCGTGAGCACTAGAAGCCGCGCGCTTCAGAGTGTCCCTTGGCAGCATGCGCTTGTTGACCAAGTGAGTGAACCGTACACGAAGATC
ACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGCTCCCGTAACTCCGAGGGTGAGTAATTGAGAGACTCCACCCAAATCCAGAACATTTTC
TCACATGCGTTTCAGTTGGGACCGTTTTCGGGGAGAACCCAGGGGTAGACCCAGAGAGGGTAGAGACCACCCTGGCTCTCGGTTTTTTTACGACAAGTCG
TGAAGTCCTTCAGAGGGATTCCGGGCGGCGCGAGAAGCACGCACCGGGCCGCCTCCAAGTCGTCGACGAACAGCCGCTCCTTCGGAACCAGGGTACGTTC
GTAAGCGCCCTTAGAATTGTGGTCGCCAACAAGACCACGAGAAGCGATGAGAATCTTCAGGAAGAGGTCAGCCCCAGAGCTCTCCTCAGGAAGCCAATAA
CCTCCTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGCATCCCCACGCGTGCGCTGGGCAGCTTGGAAGTCCTACTGCTGCTGGTCGAGGT
CGTTTGTGATCTTCCGAAGCTCAGGAATAGCACCCTCCTCCTCCTTCTCCTCCTCGTCTTCTTCATCCGAGGAGCCGAAGAGGTTCCGATAGAAGTATCC
ACTCTCCTTCTCCTCGTGGAGTGGAGAATTCGAAGCTGGGAGAGGGCTTGACGTCTTCGGCTTTAGCTGCCTTATTACGCGCAAGCATCTCAACAAACGA
TAGACGTTTGCGGGGTTTCTCTTCCTCATCTTCGCCAGCTTTGGGAGTGCTCCTGGACGCGGCCTCGTCCTCACTGCCCGAGCTAAGCTCACGTTCGGCG
AACCACGGGTTGGGGCGGTTGTTTGGAGAGACCGAAGGTGACGGACTGCGGCGCTTTCTCGCACGCTTGCTTACGGCCGCGTCGACAGTTGAGCTGATCG
CCTCGAAGGCCACCTTAGTAGCCTCCTGGAGTGCAGAGACTTTGCCGTGAGGCTTAGCGCTCTTGGTTTGCGCCTTTCCGGCAGCAGCCTTTAAGAATGT
CTTTGTACCGCTCTTCGCAGTGCCACGGGGCATGAAAACAGTCGATGTGGAGACCAAGAAGAAGTGAGCTAGACCGCCGCTCGAGGCTCTAACTGTGAAG
TGAGCTTCCGCCGCGCTCGTGCAGCCAAGTCGATGTATTTCGACTGTGAGAATGAGAGTCTGTGACGTACACTTCTTTATTCTGATTGGTCGGTATACCG
ATCCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCTACAGTGTACTCCGGGTTACATGAAGTGTGATACGTCATACTTCGAGATATCTGGTACAAGGT
ACCACGGTCGTCCGAGGCCCACCATTGGCTGATGACATTGCTTTTATATAGGAGACTTTAGTTTGTCTGTTTAACTCTAGTTTAGCCCACCTTTAAATAG
AATCAGTTTACAACTCGCCAGTACCTAAATTTGGTCACTTCGCTTCCTTTGGCAACTGGGACCTGGAAGCTGACGTTCACTGAGAGTTTGTAAACTCTCG
GAAGCCGACTTCCTCTAGCGCAAGGTACCCCGTCACA