Description :
From Genome Similarity Track
Location :
contig_15:654620- 659014
Transcript NameFunction/comments
g4307.t1XP_009517137.1 hypothetical protein PHYSODRAFT_284526 [Phytophthora sojae
g4308.t1OWZ13363.1 hypothetical protein PHMEG_00013327 [Phytophthora megakarya
g4309.t1ETL27755.1 hypothetical protein L916_18759 [Phytophthora parasitica

Sequence
4394 bases(100 bases per row)
AGTCGCCCATGGCTGTCAAAGTGAAGAAGGTCAGGACCAAGAGGCCCAAGGAGGTGATGCTGGGCATCTGTGGTGGCGTAGGACCCGCCGCCGGGCTGCT
ACTGCATCAGCTCATACTGCAGAACACCGACAGCGCTGGAGAAGACCAAGGCCACTTGAACGTCTGCCACTTCTCGCGCTCCGAAGATATGACGGACCGC
ACCGAGTACCTGGTTTACGCTGCGAGCTCCAGCGCTGAAGCGACCGATTCAGACTCGGATAGCGGGTCGTCTCCTGGAGAAGTACCTTGTGACAGCAAAG
AGTTGGCCAAGGAGGTCGGGAACCCGGCGTGCGGCATGGCCCGCACGTTCGCCATGATGCACGCTGCAGCTACGGCAGGACGTGCGCGGCTCGTGGTGGG
CGTGCCCTGCAACACATTTCACGCTCAACCAATCTGGGACGAATTCATTCGACGCACGGCTCACGCTTGCAATGTGCACCATGTGCATATGCTGGAGGAG
ACAGTGGCGTGCATTGCAAGAGAGTTGCCACTGTGTAAACGCATTGGTTTAATGTCTACGACGGGTACTCGCGAGTCGCGTGTATATCACGACCTGCTCG
AGCCTCGCGGTTATAAGGTTGTCGAGGTGTCTGCGGGAGCGATGCAGCAAGAGCTGCATGAATCGATATATAACCGCGAATGGGGAGTGAAGAGTACAGC
GCCGGCCGTGTCACCTCGTTCCGAGGCCAATTTCCAGCGCTACGCTAAGCTTGTGCGTGAACACGGGGCTGAGGCTATCATCCTGGGTTGCACCGAGATC
CCGTTCGTATTTGCTGGCAAGACACATTTCGCTGGCGTTCTCCTCATAGACCCGATGGTGGCGCTTGCCCGCGCCATGATTCGCGAGGCCGACCCATCGC
GGCTGAAAGCTCGAGGCACCAGCAACACAGCCAAGGTGTCGAGTGTGTATTCTGTCGTGCCTCTGTGTGCACCCATGGCATGCACGGGTCCATTAGCACC
GCTCAAGTATGTTGGCAGTTCAAGGTCTTCAACGGCAGCGCCATCATCAGGGTAACCTCATGCTACGTAAATGATGCTTGTAGACCTGAAGGTATTAGAT
CGTAGTACGAATCAATCGGAGCTCCAACATTATTTACTTGCAACTAGATCAATGATGAAAGCTGGTTAAGGAAGTCTGTCGCCTTCTTAGACGCTGCGGA
GTCCACAGCAGCATCCGTACTTTCGTTCTTTACCCCGCCATCACCACTCGCCGCTGCTCCATCTCGCTGTTTGCGAAGACGCTCCAAGCGCTGCTGCTTC
CTCGACTTCTTATCAATTGCACCTGCAGAGGCAGCGGGCGCCAGTGACCGCGCAAGTGTCGCTCGCTCATGAACCTCCGTCAGATGCTTCTTCTCCGCGG
TTTTCAGCCGCTTCTCCCACTGCGAGATGACAAAGCTGCCCCCACCAGCCTTATCCTCTTGGTCTCTGACCTCCTCCCTCTTTACTTCATCGTTCTGCTG
TTGAGTCTGCACAAAGGCCGCGTACTCCTCGCTGTCCGGTGCAACTTGTCTCGAGCGTCCGAACTCGTCCGTAATCTCCACACTCGTCGCCTTCCTGCTT
CTGTCCTGAGTCATGAACTTCTTTGCTTCAAAGTCCACGAGACACTCTCCCTTCAGACTGTCGTTGCCACCTCCATTGACCATTTCCTCGTACAATTTTG
CCTTCTTGCGCAGCATCACCGCCGACTTTCGACTCCACGCTTCGTCGTCGTCTTCATCCGGCGCTTCCTGCTGCTTGACCTCTTCGTCGCGGCGTCTGCG
GACCTCCACCCCGCGGTTACGGTGCCTTTTGTCCTCGTCCGAGCTCTTGCGACGCTTGTTGCCGCCTCGCAGATGCGCATATTTGCCCAGTCGCGAGCTG
CCGTCGTCGTTCTCGGCCGTCAGAGCCTCTTGCAGCCGACGCTTCCGCTCTTGGTCCTTCTGGGAGACCAGGGCCTTGAGGTCCACGAGACTCTTGGCGT
CCACATTGATGGTCTTGCCCTTGGACGGCACGAGCGCCGATTCGGTAAGAAACCCGAGCGACATGCTGCGCTTTTTGTGATTTGTGCTGTTTTTTAGGAT
GCTAACGTTATTTTGATTGTAGAATAGTCCGGTTTTGAGCACTTCAACTTGGGTGGTTTCCTGTTTCTTGTGGTATTTCTGTTGGTGTCTTGACGAGTGA
GTTTAATTGGATTGGGCGTGCTGCTATCGACAGGCGGCTTGCATCTACCGAGCAGGACTCTTGCTGCGGGGGGAATTTGCAGCCGTCATGTTCCGCAGGT
CGGTCAACTCACATATTGTGCCAGTGATCACAGATCCCGACGCTGCTGCTACGAGCTTAGAAGCGGGGGCTGCAATGGAAGAAACGCGGTCGATACCGCC
TGCACAGCAAGAACCAGCCACGGGCCCGAGTAGCCCAACATTTCTCGGCCGGAATAGCAGACACGAAAGCAAGACAGCTACTCAAGCAATTCCAGGTGCA
CCCGGCACACTACGACGAAGCAATGCCTGGGCTCGCTCGTCTGGAAGTTTGCGGAGACTCGCGACGGAGAAGTCCAGCATAAATGTACTGCGAATGTCGC
TGCTCGATCTCCACGAGCGAATGCGTTATCGTTGGGTGCTGCATCCGCAATCTCCACTCAAGACCAGTTGGGACCTCGTCAGTGCGTTAGTCGTTGTTTA
CTACTCCTGGATTATCCCATTTATGCTGTGTTTCGACTGGTACGAGCCATCGCAGGGCACCTACATATTCATGAAAGTGTTGGATGTGTGGGGGTTCCTG
GATATCGCGTTACGATTTCGGACGGGGATTATCGAGTACGGCGCCGTGGTGATGAATCCGCGCTCCATACGACGAGCCTACATACGCTCTGTATGGTTCC
CCATTGATATTGCCTCCTCCATTCCGTTCGAGTACTTTCTTAAAGACAGCGCGGCCAGTATGTCAACGAGGAAATCGTTCAAGATGATCAAGTACATCAA
GCTGCCACGCTTGCTGCGTCTAGGCCGTTTCGTCAAGTATCTTCGGCGGTACAAACGCTACTCGAGCGTCATTATCACACTCAACGCGGTCATTTTCTCC
GCCCACGTGGCTGGTTGCCTGTGGGTCGCCATTCTCAAGCCTTGCGCTGACGCAGTCGAAGCCACCCGACCGCACTGCAACGGTGGAGGAGAGATGGACG
TTTACTGGGTCGCCTTCCACCACGGCATTGTGTCCATGTTGGGCGTATCCGCTACACATGTAGAAGCCCGCGACCGCTTTCTCAGTGGGGGGTACAATCA
TTCACCCAGTGACGACTTGAACAGTGCTATCTATCTGTGGTCCAGTGGAGTATCCGTGTACGGCGTCATTTTGACCTCCATAGTGTTTGGCACCATTATC
AACCTCGTCCAAAGGTATTTGAAACAGTTTGTCCTGTGAAAGTCCAGGCAACTAACAATTGTTTGTGGAACGATAGCTGGAACAGGGCTGAGAACGCGTT
TCGTAAGAAAATGGACCATGTCACTCACGAGATGGACGCGTTGAGCTTACCCAAGTCGTTGCGGGTCCGTAATATTCTTGTTGTACCTCATACAAGCCGC
TAACTTGGTTCACTGACCGACGGTTGTTTGGGTTTGCTGCAGGCACGGGTGACAGCTTACTATGACTACCTCTGGCTCAACGTACGTTCATCTTGCGACC
ACGCCTCCCCCGATCGTTTACTGACCTTTGCTGCTGCAATTGCAATCCATCCGCAGAATCGTGCTCTGTCGGAGCAATTGAATTTGCTGCACGACCCGGG
CATGTCGTTGACGCTGCGCCGCCAAGTAGCCATCTACCTTTTCAAAGACAACCTGCAGAAGATTCCGTTCTTCCAGCTAGCCACGGACGCGGTATTGGGC
ATGATCTGCATGCAGCTTCACCAAGTTATCTACATGCCGGACGACTACATCATCACCGAAGGAGAAATCGGCAAGGAGCTGTTCATGATTGTGAAAGGTA
TCGTGCGCGTGCTTCCACCAAAAGGCTGCAAGAAGCCCGAGACCGAAACGATCATTCTGCTCAGCGAGGGCGATTTCTTTGGCGAGATCGGAGTGGTCAT
GGAGGTCGAGCGCACACGAAGTGTGAAGGCAGAGTGCATGGCTGAGCTATGCGTTCTCGCCCGGGAAGGCTTTGACAAAATCTTGGTCGAGTTCCCCGAG
TTCGCGACCGCCATGAAGAAGCTCATCGTGAAGCGCGTGGGCGAAATGTGGAAGGACGACGGCCCCGAGCGCATGGAAAAGATGACGGCGCTCGCCGACG
CCAAGATGAAGAAGACCATTCAGGCCTACAAGAACATGGACAAGCTGCGGAACAAAACGCGAGTCCTTGCAAACTTCCGTCCGCGGTTGTCGAA