Description :
From Genome Similarity Track
Location :
Scaffold_773:6546- 7618
Sequence
1072 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAGGACGACGCTAAATCAGCAAAACAAGCTCGCAGAGAGCATCGGGCAGCAATGGCAAAGGCCGCGA
AGGAGAACAGCGACCACCGAGGAAGAAACGAAGGCAACACGAGTGCAGCGACGAAAAAGAGAAAGACAAACAGCGAGTAAGCTGCTGCAGTCTAAGGGGA
TCAAAATGATACTTCCATCCATTTCTCAAACGAATTGTTACTTATCTACATATCCGCGTCACTAGCTCGGGGTAATAACTTTACGACGCGATTTGAGCAC
GTTCTGCTCGGAAATGGTCGAATCCGATAGTACCATTCGAACCGCCGGCCCATTTTACCTTTGGTTCACCAAAACAAATTCCATTTTTGCTCTGGGAAGG
GAGATAATTTTTCTGAGGGCCTATAACTTCGTCGGTTTCAACTCCTGGGAGGTGTGGGTGGGCTCAAATGAAAGAGGAGACGCCCTTCTTTCCATTGGTG
TGCCTAAATCGCGATTCGTACTTAGGTTCATTAGAGGATGTTAGCAAATTGGTATTTTACGAGTTGGGGACAAAGACACTCGACCACCGCTGTCTATGTC
CCCGAACTCGTAAGAGGGGAGTCGTGTTAGTACGGAATCTCCCGAGAAACTCGTAAGGCATTTTCACGAGATTACAAGCCTTCTGATTGGCTCGTTACTC
TCATCCCGCATCTCCCCTTCGAGCACCATGGCCGCCATGGCGCTTACAGGTACCTGTAGCGCCGCGACTCGAATCGAGTCGCGGTGGTTCGAGTCACTCG
AACCACCTCATCCAGTCTCAAGTGCCCCCCCCCCCTAATCAGTGTGACGTCCTTGCCTCTCCCAGCGAGGCACACGAGGATGACGACGATTCGGCTACGC
GTCTTAAGTCATAACGGCGCGTCGAAGTAGAGTAGGCAGCCATTGACCACAAAGAGCAGCATAAAGTAGAAT