Description :
From Genome Similarity Track
Location :
scaffold_31:65459- 67744
Sequence
2285 bases(100 bases per row)
CCATAAAGCGAGGACTCATGCTCTTAAAATCCAAGCTGGAACTTGTAGCGATGTGAGTATAGAGTGTGAAAGTGCGTTAGAACCTTGAAGACACGCTGTA
AATGTAAGTGCATCAGTGTTAGGCACTGTCAAAAGACTTTTAAAACATGAAGACAAGGTACGTCGTAAATTGCTTTTTACGATTATTCCCCAATGTTTGC
AAGATACAACACCAGGTGAAGTTGAATAGTCAAATATTAAGCCAAAAGTAATTGAATCCAGAGTGAACAATTTGAAAGGGTATTCCATAAAGTGAGGACT
CATGCTCTTAAAACCCAAGCTGGAACTTGTAGCGATGTGAGTTCAGAGTGTGAAAGTGCGTTAGAACCTTGAAGACACGCTGTAAATGTAAGTGCATCAG
TGTTAGGCACTGTCAAAAGACTTTTATAACGTGAAGACAAGGTACGTCGTAAATTGCTTTTTACGATCATTCCCCAATGTTTGCAAGATACAACACCAGG
TGAAGTTGAATAGTCAAATAGAAAAATTAATACCAAAGTTGCGTTGCAGTCATTACAACTTGATGGAAGTTTTCTACCTATAAATTACTGGTCAACACGG
CGCAGGATTCAACGTGATATTCTTCCCGCCTTGTCAGACTTTCTTTTTCGACTACAACATAATGGCTTGTACTTTGTATATAAATGTGGCTGATACACTC
AAGATAACAAATGTGCTCATCGTTGTTCTACGCCAGAACCTCCAAAGCATTTACTATGAGAATGCTACACAGCCAACACTATATGGCGTCTCTCATTTCA
TTGGATTTCCGCGACAACTATACAATGAGAACACGCCTCATTCCTCATTTATTTCACTGTTCCCAGTGATCGCCAACAGTTATTGCGGTGGAGAACTTGA
GTTGAGAAGCCGGTGAATTTAACTGCTGTTGGCGTAAATAATGTCTTTGTCGTCAAAAGTCCATATATGGAGTGCAGCAAGCATTCCTTCAGGAGAGCTC
GAATATATCATGAATGTGCTGTAGTGACTTGGAACACTTATTTTGTCTCTACTACTCGTGTTATTGAGCACGCAGTGTCGATAGACGAGTCTGATAGTGA
TTCACGCAGCATTAAAGGGCCAGGGATTGAGCCAAAATAAACGCAAAATGTAGAGACTCAGAATATACGATGATGAGACATATATTGACATATTTTTCGA
TGTAGCACAGCAAAAATTTTCTCTGATAAGTAAATCGGGGAAAGATATTGTTTCATAATGGTCAGGTCAGCTAAGTGATTACCGTATTATCATTCATAAC
CTTAGGCAAAAAGTTTAGTGCGTCATAGTGCAAGCGCTGAAAGCGTGGACAATGAGCCAACCTCATGTGGTTTTTTTTGCACAgagtgctggacaccaat
GCAATCACTGCCGATATAGAGGGACGTTTACTCAGCGATTAGTTGTTGTAAAGGACTGCAGGGGCATATATAGATAGACTCAGCCCCTACCTTGACCTTG
AAGCGCACAATCGAAAGCAGTTTGAGCTAGAGTAAACCACTTGGGTAGGGAGTTCAACTTGGCTCTGCAGTGTCGAATAAGTTGACGTATTAAATTGTCT
TGAAGGAGTCGGATACATTATAAAATTTTATGCCCCTAGATCCAATCGAACTGAATGCCATTTGCCGAGAAACAGTTAAGCTGTGTTTTGACGGTGGTCG
AGTATTGTTTACAAATTTCTAATCAAAGACGAAATAATTAATTTCTTCCTTAGAGACTGCTTATACACTCAGAATAAATATTGACTGAATTGTCGTCTTT
AATAGTATAACGCTGCCCTATAGCGTACGGCTCTCCAACGCCAGACGACGAAAGTCATTGAATACGAAGAAGTGTTTGATTCAACCATCAGCTGGGTCGG
CACTGAGGTTTCACAAGTATACAAAAAAGTGTGGTATGTTTTCATTGTTTAATACTTGGTTTCCACAGTCGCGAAAGGCATTCAGTAAAGTGTGATCAGA
CGACTTCCATGGTCGAAAAGAATATAACAGACTTGTTCATATTCAAATGCATTTCAGTTGTAGTGCAAACCTATTGCCCATGGGCGAGAAACTTAGGGGC
TTGGTGTAAGTCATATACCGAATCTGTTATGTCGTCCGTGAAGCTGTGAGTTTGACTATAAGTATCGCAAATCTttattgaaaacattgattgACCACTC
TAAGATATCACAACCAAAGCTCGAAAAAAAGAACGAACAGCCCTGGCGAACGTGGATCTCCATGTCAAAAACCCGTTCCCAAGCT