Description :
From Genome Similarity Track
Location :
contig_5:654539- 659407
Transcript NameFunction/comments
g1418.t1hypothetical protein PHMEG_00015439

Sequence
4868 bases(100 bases per row)
GCATTGACATTCTTCTGTGCCATCGCTTCATCCAACTGAAGGATCGCTTTGATAACGGCAAGTCAAGCCAACTGTGTAAAGTGAGCTGGCGATTGCTGGC
CAGTAGTGTCAGCACCGCCGTGGGCGAAGAGATCGACGTGGATCAGTGCAAGAATAAGGTACCGAATAATGTTTGATGACGTGTTGTCTCTGACATGTTG
TAATCATTGTTGCGCACATGCAGCGGTTGTGGCACTCGTACAACAAGGCGCGGGACCAGACAGAAATGCTACGCCGCCTGAAGAGCCACCGTGCTACGAT
CTAATGCATCACCTATGGTCTAAAAGCAACGGTATGAGCTCGACGCCATTCATCTCATCATCCATTCGACCCCCAGCGCGACACAAGGCATCGCTGCTCA
AGAACTTACCTCTGATGAGACGGTTAGCCAGTCCATTGCATCATTCCGTTCCTCCGAAAACCCAGCTCAAGGATCGGTCACGACTTAAACCCTCCGTCAA
AACCCAAGCCTGACGTCAAAACCCAAGCCTGAAACACAACGACCAAAGAAAAAGTACAAGACGCAAAGCGAACATGTTGCGGAAGGGATGAAACTTTTAT
CCAAGAGTAATCAGAGGTAGCCTCTGCAATTTCAAAGCCAGCAAGTGAAACCATCGCGGAGACCACGAACCAGCTGGTGCTGCAGACGCTTGCTGAAAGC
CAGCAGCGCCAAAACCAACTAACGACCAACTTCTGGAACACCACCAGCAGCAATCGAAGGCAATGCAGTTGATGTTAGCCCAACTCACGAAAATCAGCGA
GAAACTACCCGAGAACAAGTGACATGATCCCAGTCCGTTTAGCAATTGCTATTCCTCGAACTGTCCGAGTGGATACTGAATCTGGCTCGTCATTGGGTCA
TTATTGGTAGGCTCGATTGCTTCGTCAATTTCAGTTCCGTCTCCCAGCAAAATGAAAATGTTTGCATGACAACTGCTGCAGCAATAATGCGGAATGCTTT
GGGCACTGTTTTTTCAGCCATAATGGTCTTCAACCTGCAGAACCTCCCTTTTAAAAGCATTCTTCTGACTTGCGAGAACGTTCTCAAGCTTGTCATAGAA
CTATGAGGCCTGGATACCCTCATATACCATATTTATCGGCCCCAGTGCGACAAACTGTCCCAGTGCAACACTAACTCATGTGGGGGTGACACCCCTTCCC
ACACCTGTTATAATTCAATAGATTTAAAAACTGTCTAAAAGAATATGTTTATTCGCTATCAGATTCAACTGCGTCAACAACACATTCTTCTGGAAGTGAA
CGCAAATACGTCCTAAATGCGCCTGCAGCGTCACGGGGCCGACTGAAAGTAACTTAGCTTTGTGAAATCCGTTCACAATAGTCTCTGGGTTGACACTCTC
CCATGCTTTCCCGACCAAATGAGAGAGCATTGCACGCCGCTCACCGGCCGTTGACGGGAAAGGGTGCTCAATGTGATACTTCACGTACAAATCCCTGCTC
AGAAACAGAGTTAGTAAAATCATCAATCAATCGAAATCCGTGCCTAAAACTTACTGAATCTTTGCCTTGAATGATCGCATGACGCTAACGTCCATGGGCT
GGCTTAAACCGGTGATCCCTGCAGGTATGTACTAGATTTGCGTCACACATTCATCCTCAAGGTGCTCGCGGATGCTCGTCATTTTGTGTACCTTTATAAA
AGCTATCTAACAGCAGCATCCGGCATCCAGTTATGCTTGGACGCCATACCTACACCAAAGCATATTACAACCAGATGTTAATTTCTTTGTAGTTGCACAA
GACCATATTAGAGCGTACCTTTTCAATCCATTCCATCATAATTGAATGATCACAAAAGGCTTTTGGCTGCACCGTGTGTATCACCGATGAGTCACCGAAA
GACGGAACTGACACTTCTTCTGAGACGGGCCCCAGCAAACACGACGAACGGTGCGAGCTTTTTGCCGGTTGCGGATGCACACAAAAACACGTTACAGCCT
CCGCCGTTTACCGCAGTTCCCTGAACAACGTCAACGTTCGCACCCCGCGGTAGTATACGGTCAAGTGGCCAGGGTTGTCCATACAGACCGCTGTCTGGTC
CATATTAAACAGTCCAGCATATTTACTATCGTAGGACATGTGAAACGACAGCATACCGTCTTCTTCGACAGCAACATTGACCGAATTTGCAAAAGAGTCG
GCAACGTCCTAAAAAAAAATAAAACATAGCAGCAAATAGGAAATATGTGCACCCAAAAATTTAATCTTGGCAGCATAATCCCACCTGCATCTCCTTGCGA
ACATTGCTGCCTTTGTGTGTAATCCGTCGGACTATGATACGATTGCGCTTTAGAAAACGCACAGCCCACGAGCGAAGCGCTGTGTACTGGCGCGCTGCAG
CGAATTGACCGTCAAACTTAGTGATCATGAGCGTCAAGCATTTAGTTGTCAGGCACAGCTTGCGATTGTTGCGGATCTCTGCTACGTATGATATCAATCT
GTACAAATATAACATTCAGCATTTAGACACCACATATCAGAACATTTCGAGCACTTACTTGGCCTCTAGATCAGGAAAGCGAACGCGTAGAGCCTGGTGT
GCGCTGGGGTCAGCATAGAACTTCCCACTATTTGTTTTGCCAGCAAGCAGGGCAATATTCTTCTTCCACCGATATACAGTCGCGCGATGCACCAACAAGC
ACTCCGCCACTGACGCCGCGGAGGCTGTCTCCGCTGCTTGTGCTCCCTGCACACATAACAATTAGTTGCATATCATGTTAGCGCCATTCGATGATAATCT
TGCCTTGATCTTCGTCCTATTCGTGTTCTTCGGTCTTCGCGGCATGGGAGACGTTGGTTTGTGCCGGACGGATGTCATCAAAACCACACTCAATAAAAAC
CTTATGAGGTTTTTTCAAAATTACTTGATTTGCGCCAAAAACATTTGTCGCACTGGGGTCGATAAATACGGTAGGTGATACTCCATGTTCTTTCCGTTGT
AGAACCGGTACTTAGGGTCAGTCTTGTATGTAGCCAACCGACATGTGTTTTTCTAGTTTATCGATGGAGACCTTGTACTGCTTAGCTACGAGTTTCCGAT
TTTTAGGCTGGGAAATGTTGCTAATATACACCATCTTACCGGTTCTACCGCGAACCTTGACTCGGTAGCTGCTCCCCATTTAATAGCCCGAATATTTAAT
CTACTTACTTTCTCAGGATCGTAGGCATACATACATACAATAAATTATCGCTTATATTTTCCCCTCGTGGAGTCGTCTTTATAGTTATACTTTTTCCGCT
CAGTATCGTCTTTATATGTTAGACCTCTAGAAAAAAACTGAAATTAATTAATTCAGAGATACCTGGTAAAAGCCTCGTCGATCATTGGAGCCAATGATAA
TATTTTTATCGGTGACAACTCACCGCTCTTAACCCTTTGTCGAACGCTAGTACCACGTGATACTGACTTAAATCTTCAGCGTGGTACTATATCAGTGTCG
ACTTTCTATTTTCGCTATTTTTTAATTAATTAGCTAAGTTCGGCTTCGTTCGGTAAGTTCGGCTTCGCTTTGATTAATTTCGTTTTCTTTCCTTACCGCG
TACTTCCTCTGGGCGGAAATAAACGCAACAAGTCTAAATGACAGTTCGATAGGTTCCGCTTTGGGCTTTTCGCAAAAAAAAATGCGTGTGATCACTTTTG
GCAGGTATTGTATGTTGAAGACTCATTCCAGATCAAAATCAAACAGCAACACACTGGGGCCAGCTTCACGCAGCACATCGAGTGCGGCACTGACTGCGTC
TGGAGGGCATGAGAGTGACCGCGGAAGCAAGCCTTTCTTCCTGAGCTTCTCCCTGCCCATGTGAGGCAACTTGTACTGGTTCCCGCCGCTGTCGCGCAGA
GTGCAGATCATGCAGTTCTGCAGAGTCAGAAAGATGTTGTCCTGGGTCGTCTCGCTCAACTCCTCGTACGCAGCCTCGACGGCGTCGATCAGCTCGTCCA
CCCCACGGATAACGACTTGGTACTGTAGAGCCTGGAGCGCCGCGAACAGTCCCAAGTCGAGAACGTTGAGATCGGGGGAGTTCGGAGGCTGGCAATACAT
GCGGATATTCCAGCCCTGCGGCCAAGACGTCCGCGTCGAACGGAGAGACATGAGATTTGGCGTTGTCTTGCTGAATGTATATGAGCTTGCCGCGGTCTCG
TCGCGGCCAATTCTCATTTATAGCCGGGATCAAATACTCCAGGAGGTACCGCTTGTAGAGACGTCTGTCGACCGTCTCAACGTTGCGCGTGACAATAGCC
CCCTCGGACGATTGACACTCGATCGTTGGGCGACATACTCCTCGGTGAACGACCAGATCCCAAGCTTCCCGTCCCACGTTGCATTACGGTGGGAATCATG
CCTATCAATCACATGATAAAGTGTTAGAGGTAGCAGAAACTATTCAATCATTGAATATGGCAGGTCATACTCGGTCGCGTGACGGCAGCCAGGAACATGG
TCTTGTTGATGAAGCGCTTGCTTCGCCGGTGCCGTGGTGGCGCTGTTTCGCCCGGCAGGACAATGTACGACCGCTTGTCCTTGTCTTCATTAAACCACTT
CTCATCGACATGAACCATGTTGTCCATAGGCTCGAACTCGAGCGTCCGATCGTCGACAAAGCCAAGGACAAACTCAAGCCGTTCCAGCTTGTTTTCCTCC
GAAAGCAGAGGTTTGATCCGCCCTGACGCACGATTCAGCTCCTCCTCGCGCAGCATTGCTCTCACCAGGTACCGAGAGATGCCTGCGTGGTGAGCGGTTT
GTCTCTAGACTTGGCGATCTTCAATGGGGACCGCTGCCACGAGCGCTTGCAGCTTCTGTCGGTCTACC